Dugong, population genetics, Illumina FASTQ, skin
Dataset size is: 0.00 Bit
This dataset is currently under a short embargo period until February 11, 2026 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
This dataset has no data
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
Access Control Date | 2026-02-11 |
Access Control Mode | date |
Sequence Data Type | illumina-shortread |
access_rights | Location information restricted |
analysis_software | DRAGEN BCLConvert |
analysis_software_version | 4.1.23 |
base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/illumina-fastq/BPAOPS-1748/Lane3/ |
bioplatforms_project | Threatened Species Initiative |
ccg_jira_ticket | BPAOPS-1748 |
class | Mammalia |
collection_date | 2024-01-01 |
collector | Mercy Baird |
common_name | Dugong |
country | Australia |
data_context | population genetics |
data_custodian | Eva Paulus |
data_type | Illumina FASTQ |
dataset_id | 102.100.100/358899 |
date_of_transfer | 2025-02-11 |
date_of_transfer_to_archive | 2025-02-17 |
description | Dugong Illumina WGS |
facility_project_code | NA |
facility_sample_id | 628138_TSI_BRF_22KYTHLT4_GGAGCGTGTA-ATCCGTAAGT |
family | Dugongidae |
file_type | fastq.gz |
flowcell_id | 22KYTHLT4 |
flowcell_type | NovaSeq X 25B |
folder_name | 20250210_TSI_BRF_358899_22KYTHLT4 |
genus | Dugong |
habitat | shallow marine |
insert_size_range | 400 bp |
institution_name | James Cook University |
library_construction_protocol | Illumina DNA Prep |
library_id | 102.100.100/628138 |
library_index_id | UDP0088 |
library_index_id_dual | UDP0088 |
library_index_seq | GGAGCGTGTA |
library_index_seq_dual | ATCCGTAAGT |
library_layout | Paired end |
library_location | BRF Freezer |
library_ng_ul | 6.55 |
library_oligo_sequence | CAAGCAGAAGACGGCATACGAGATggagcgtgtaCTGTCTCTTATACACATCTCCGAGCCCACGAGAC |
library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACAC atccgtaagtTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG |
library_pcr_cycles | 6.0 |
library_pcr_reps | N/A |
library_prepared_by | Lachlan Morrison |
library_source | Genomic |
library_strategy | Tagmentation |
library_type | illumina-shortread |
lifestage | adult organism |
location_text | Yarrabah |
material_conc_ng_ul | 165.0 |
material_extracted_by | Eva Paulus |
material_extraction_date | 2024-12-01 |
material_extraction_method | DNeasy Qiagen Blood & Tissue Kit |
material_extraction_type | DNA |
metadata_revision_date | 2025-08-26 |
metadata_revision_filename | 20250826_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
n_libraries_pooled | 1.0 |
order | Sirenia |
phenotypic_sex | not determined |
phylum | Chordata |
sample_custodian | Eva Paulus |
sample_id | 102.100.100/627150 |
sample_type | tissue sample |
scientific_name | Dugong dugon |
scientific_name_authorship | Müller, 1776 |
sequencing_facility | BRF |
sequencing_model | NovaSeq X |
sequencing_platform | Illumina |
species | dugon |
specimen_id | EP75 |
specimen_id_description | Eva_Paulus_sample_75 |
state_or_region | Queensland |
taxon_id | 29137.0 |
taxonomic_group | Mammal |
ticket | BPAOPS-1748 |
tissue_collection_type | university |
tissue_number | Yarrabah |
tissue_preservation | ethanol |
tissue_preservation_temperature | -20.0 |
tissue_type | skin |
wild_captive | wild |
work_order | 14083 |