Dugong, population genetics, Illumina FASTQ, skin

Dugongidae, Dugong dugon, EP03, Mammal, Project Lead: Eva Paulus

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

This dataset has no data

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members
Access Control Date 2026-02-11
Access Control Mode date
Sequence Data Type illumina-shortread
access_rights Location information restricted
analysis_software DRAGEN BCLConvert
analysis_software_version 4.1.23
base_url https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/illumina-fastq/BPAOPS-1748/Lane3/
bioplatforms_project Threatened Species Initiative
ccg_jira_ticket BPAOPS-1748
certainty certain
class Mammalia
collection_date 2018-08-06
collector Rachel Groom, Christophe Cleguer, Shaun Evans, Sebastian Evans, Damian Pracy, Stanley Allen, David Barrett, Steven O'Keefe, Anton Johnston
common_name Dugong
country Australia
data_context population genetics
data_custodian Eva Paulus
data_type Illumina FASTQ
dataset_id 102.100.100/358899
date_of_transfer 2025-02-11
date_of_transfer_to_archive 2025-02-17
description Dugong Illumina WGS
facility_project_code NA
facility_sample_id 628079_TSI_BRF_22KYTHLT4_GCCGCACTCT-TCCGACCTCG
family Dugongidae
file_type fastq.gz
flowcell_id 22KYTHLT4
flowcell_type NovaSeq X 25B
folder_name 20250210_TSI_BRF_358899_22KYTHLT4
genus Dugong
habitat shallow marine
insert_size_range 400 bp
institution_name James Cook University
library_construction_protocol Illumina DNA Prep
library_id 102.100.100/628079
library_index_id UDP0029
library_index_id_dual UDP0029
library_index_seq GCCGCACTCT
library_index_seq_dual TCCGACCTCG
library_layout Paired end
library_location BRF Freezer
library_ng_ul 1.54
library_oligo_sequence CAAGCAGAAGACGGCATACGAGATgccgcactctCTGTCTCTTATACACATCTCCGAGCCCACGAGAC
library_oligo_sequence_dual AATGATACGGCGACCACCGAGATCTACAC tccgacctcgTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
library_pcr_cycles 6.0
library_pcr_reps N/A
library_prepared_by Lachlan Morrison
library_source Genomic
library_strategy Tagmentation
library_type illumina-shortread
lifestage adult organism
location_text Gulf of Carpentaria
material_conc_ng_ul 53.0
material_extracted_by Eva Paulus
material_extraction_date 2024-12-01
material_extraction_method DNeasy Qiagen Blood & Tissue Kit
material_extraction_type DNA
metadata_revision_date 2025-08-26
metadata_revision_filename 20250826_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx
method_of_determination direct observation
n_libraries_pooled 1.0
order Sirenia
phenotypic_sex female
phylum Chordata
sample_custodian Eva Paulus
sample_id 102.100.100/627091
sample_type tissue sample
scientific_name Dugong dugon
scientific_name_authorship Müller, 1776
sequencing_facility BRF
sequencing_model NovaSeq X
sequencing_platform Illumina
species dugon
specimen_id EP03
specimen_id_description Eva_Paulus_sample_03
state_or_region Northern Territory
taxon_id 29137.0
taxonomic_group Mammal
ticket BPAOPS-1748
tissue_collection_type university
tissue_number NT17044
tissue_preservation ethanol
tissue_preservation_temperature -20.0
tissue_type skin
wild_captive wild
work_order 14083