Dugong, population genetics, Illumina FASTQ, skin
Dataset size is: 0.00 Bit
Data and Resources
This dataset has no data
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2026-02-11 |
| Access Control Mode | date |
| Sequence Data Type | illumina-shortread |
| access_rights | Location information restricted |
| analysis_software | DRAGEN BCLConvert |
| analysis_software_version | 4.1.23 |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/illumina-fastq/BPAOPS-1748/Lane3/ |
| bioplatforms_project | Threatened Species Initiative |
| ccg_jira_ticket | BPAOPS-1748 |
| certainty | certain |
| class | Mammalia |
| collection_date | 2018-11-29 |
| collector | Rachel Groom, Christophe Cleguer, Shaun Evans, Sebastian Evans, Damian Pracy, Stanley Allen, David Barrett, Steven O'Keefe, Anton Johnston, Christophe Cleguer, Shaun Evans, Sebastian Evans, Damian Pracy, Stanley Allen, David Barrett, Steven O'Keefe, Anton Johnston |
| common_name | Dugong |
| country | Australia |
| data_context | population genetics |
| data_custodian | Eva Paulus |
| data_type | Illumina FASTQ |
| dataset_id | 102.100.100/358899 |
| date_of_transfer | 2025-02-11 |
| date_of_transfer_to_archive | 2025-02-17 |
| description | Dugong Illumina WGS |
| facility_project_code | NA |
| facility_sample_id | 628056_TSI_BRF_22KYTHLT4_AACATCGCGC-GTCCACTTGT |
| family | Dugongidae |
| file_type | fastq.gz |
| flowcell_id | 22KYTHLT4 |
| flowcell_type | NovaSeq X 25B |
| folder_name | 20250210_TSI_BRF_358899_22KYTHLT4 |
| genus | Dugong |
| habitat | shallow marine |
| insert_size_range | 400 bp |
| institution_name | James Cook University |
| library_construction_protocol | Illumina DNA Prep |
| library_id | 102.100.100/628056 |
| library_index_id | UDP0006 |
| library_index_id_dual | UDP0006 |
| library_index_seq | AACATCGCGC |
| library_index_seq_dual | GTCCACTTGT |
| library_layout | Paired end |
| library_location | BRF Freezer |
| library_ng_ul | 9.1 |
| library_oligo_sequence | CAAGCAGAAGACGGCATACGAGATaacatcgcgcCTGTCTCTTATACACATCTCCGAGCCCACGAGAC |
| library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACAC gtccacttgtTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG |
| library_pcr_cycles | 6.0 |
| library_pcr_reps | N/A |
| library_prepared_by | Lachlan Morrison |
| library_source | Genomic |
| library_strategy | Tagmentation |
| library_type | illumina-shortread |
| lifestage | adult organism |
| location_text | Gulf of Carpentaria |
| material_conc_ng_ul | 70.0 |
| material_extracted_by | Eva Paulus |
| material_extraction_date | 2024-12-01 |
| material_extraction_method | DNeasy Qiagen Blood & Tissue Kit |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-08-26 |
| metadata_revision_filename | 20250826_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| method_of_determination | direct observation |
| n_libraries_pooled | 1.0 |
| order | Sirenia |
| phenotypic_sex | male |
| phylum | Chordata |
| sample_custodian | Eva Paulus |
| sample_id | 102.100.100/627068 |
| sample_type | tissue sample |
| scientific_name | Dugong dugon |
| scientific_name_authorship | Müller, 1776 |
| sequencing_facility | BRF |
| sequencing_model | NovaSeq X |
| sequencing_platform | Illumina |
| species | dugon |
| specimen_id | EP09 |
| specimen_id_description | Eva_Paulus_sample_09 |
| state_or_region | Northern Territory |
| taxon_id | 29137.0 |
| taxonomic_group | Mammal |
| ticket | BPAOPS-1748 |
| tissue_collection_type | university |
| tissue_number | NT17039 |
| tissue_preservation | ethanol |
| tissue_preservation_temperature | -20.0 |
| tissue_type | skin |
| wild_captive | wild |
| work_order | 14083 |