Dugong, population genetics, Illumina FASTQ, skin

Dugongidae, Dugong dugon, EP01, Mammal, Project Lead: Eva Paulus

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

This dataset has no data

Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members
Access Control Date 2026-02-11
Access Control Mode date
Sequence Data Type illumina-shortread
access_rights Location information restricted
analysis_software DRAGEN BCLConvert
analysis_software_version 4.1.23
base_url https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/illumina-fastq/BPAOPS-1748/Lane3/
bioplatforms_project Threatened Species Initiative
ccg_jira_ticket BPAOPS-1748
certainty certain
class Mammalia
collection_date 2018-08-04
collector Rachel Groom, Christophe Cleguer, Shaun Evans, Sebastian Evans, Damian Pracy, Stanley Allen, David Barrett, Steven O'Keefe, Anton Johnston, Christophe Cleguer, Shaun Evans, Sebastian Evans, Damian Pracy, Stanley Allen, David Barrett, Steven O'Keefe, Anton Johnston
common_name Dugong
country Australia
data_context population genetics
data_custodian Eva Paulus
data_type Illumina FASTQ
dataset_id 102.100.100/358899
date_of_transfer 2025-02-11
date_of_transfer_to_archive 2025-02-17
description Dugong Illumina WGS
facility_project_code NA
facility_sample_id 628055_TSI_BRF_22KYTHLT4_CACAATAGGA-TCCATCCGAG
family Dugongidae
file_type fastq.gz
flowcell_id 22KYTHLT4
flowcell_type NovaSeq X 25B
folder_name 20250210_TSI_BRF_358899_22KYTHLT4
genus Dugong
habitat shallow marine
insert_size_range 400 bp
institution_name James Cook University
library_construction_protocol Illumina DNA Prep
library_id 102.100.100/628055
library_index_id UDP0005V3
library_index_id_dual UDP0005V3
library_index_seq CACAATAGGA
library_index_seq_dual TCCATCCGAG
library_layout Paired end
library_location BRF Freezer
library_ng_ul 10.5
library_oligo_sequence CAAGCAGAAGACGGCATACGAGATcacaataggaCTGTCTCTTATACACATCTCCGAGCCCACGAGAC
library_oligo_sequence_dual AATGATACGGCGACCACCGAGATCTACAC tccatccgagTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
library_pcr_cycles 6.0
library_pcr_reps N/A
library_prepared_by Lachlan Morrison
library_source Genomic
library_strategy Tagmentation
library_type illumina-shortread
lifestage adult organism
location_text Gulf of Carpentaria
material_conc_ng_ul 47.0
material_extracted_by Eva Paulus
material_extraction_date 2024-12-01
material_extraction_method DNeasy Qiagen Blood & Tissue Kit
material_extraction_type DNA
metadata_revision_date 2025-08-26
metadata_revision_filename 20250826_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx
method_of_determination direct observation
n_libraries_pooled 1.0
order Sirenia
phenotypic_sex male
phylum Chordata
sample_custodian Eva Paulus
sample_id 102.100.100/627067
sample_type tissue sample
scientific_name Dugong dugon
scientific_name_authorship Müller, 1776
sequencing_facility BRF
sequencing_model NovaSeq X
sequencing_platform Illumina
species dugon
specimen_id EP01
specimen_id_description Eva_Paulus_sample_01
state_or_region Northern Territory
taxon_id 29137.0
taxonomic_group Mammal
ticket BPAOPS-1748
tissue_collection_type university
tissue_number NT17031
tissue_preservation ethanol
tissue_preservation_temperature -20.0
tissue_type skin
wild_captive wild
work_order 14083