Dugong, population genetics, Illumina FASTQ, skin
Dataset size is: 0.00 Bit
Data and Resources
This dataset has no data
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2026-02-11 |
| Access Control Mode | date |
| Sequence Data Type | illumina-shortread |
| access_rights | Location information restricted |
| analysis_software | DRAGEN BCLConvert |
| analysis_software_version | 4.1.23 |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/illumina-fastq/BPAOPS-1748/Lane3/ |
| bioplatforms_project | Threatened Species Initiative |
| ccg_jira_ticket | BPAOPS-1748 |
| class | Mammalia |
| collector | unknown |
| common_name | Dugong |
| country | Australia |
| data_context | population genetics |
| data_custodian | Eva Paulus |
| data_type | Illumina FASTQ |
| dataset_id | 102.100.100/358899 |
| date_of_transfer | 2025-02-11 |
| date_of_transfer_to_archive | 2025-02-17 |
| description | Dugong Illumina WGS |
| facility_project_code | NA |
| facility_sample_id | 628053_TSI_BRF_22KYTHLT4_CGACATCCGA-TACGTTCATT |
| family | Dugongidae |
| file_type | fastq.gz |
| flowcell_id | 22KYTHLT4 |
| flowcell_type | NovaSeq X 25B |
| folder_name | 20250210_TSI_BRF_358899_22KYTHLT4 |
| genus | Dugong |
| habitat | shallow marine |
| insert_size_range | 400 bp |
| institution_name | James Cook University |
| library_construction_protocol | Illumina DNA Prep |
| library_id | 102.100.100/628053 |
| library_index_id | UDP0003V3 |
| library_index_id_dual | UDP0003V3 |
| library_index_seq | CGACATCCGA |
| library_index_seq_dual | TACGTTCATT |
| library_layout | Paired end |
| library_location | BRF Freezer |
| library_ng_ul | 0.511 |
| library_oligo_sequence | CAAGCAGAAGACGGCATACGAGATcgacatccgaCTGTCTCTTATACACATCTCCGAGCCCACGAGAC |
| library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACAC tacgttcattTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG |
| library_pcr_cycles | 6.0 |
| library_pcr_reps | N/A |
| library_prepared_by | Lachlan Morrison |
| library_source | Genomic |
| library_strategy | Tagmentation |
| library_type | illumina-shortread |
| lifestage | adult organism |
| location_text | Port Douglas |
| material_conc_ng_ul | 34.0 |
| material_extracted_by | Eva Paulus |
| material_extraction_date | 2025-01-01 |
| material_extraction_method | DNeasy Qiagen Blood & Tissue Kit |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-08-26 |
| metadata_revision_filename | 20250826_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| n_libraries_pooled | 1.0 |
| order | Sirenia |
| phenotypic_sex | not determined |
| phylum | Chordata |
| sample_custodian | Eva Paulus |
| sample_id | 102.100.100/627065 |
| sample_type | tissue sample |
| scientific_name | Dugong dugon |
| scientific_name_authorship | Müller, 1776 |
| sequencing_facility | BRF |
| sequencing_model | NovaSeq X |
| sequencing_platform | Illumina |
| species | dugon |
| specimen_id | DB32 |
| specimen_id_description | David_Blair_sample_32 |
| state_or_region | Queensland |
| taxon_id | 29137.0 |
| taxonomic_group | Mammal |
| ticket | BPAOPS-1748 |
| tissue_collection_type | university |
| tissue_number | Port_Douglas |
| tissue_preservation | ethanol |
| tissue_preservation_temperature | -20.0 |
| tissue_type | skin |
| wild_captive | wild |
| work_order | 14083 |