Ghost Bat, Reference Genome, Illumina-HiC, heart
Dataset size is: 366.00 Byte
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2026-02-10 |
| Access Control Mode | date |
| Sequence Data Type | illumina-hic |
| access_rights | exact site coordinates should not be released to public as it is an important conservation site for ghost bats |
| ala_specimen_url | https://bie.ala.org.au/species/https://biodiversity.org.au/afd/taxa/7993d9b8-c777-41fc-984c-a1fda2c8878f |
| analysis_software | DRAGEN BCLconvert |
| analysis_software_version | 4.1.23 |
| ancillary_notes | The captured bat was clearly an older bat with very worn teeth, scarred wing membrane and a large notch missing from his ear. |
| associated_media | photos,videos |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/genomics-hi-c/BPAOPS-1746/ |
| bioplatforms_project | Threatened Species Initiative |
| ccg_jira_ticket | BPAOPS-1746 |
| certainty | certain |
| class | Mammalia |
| collection_date | 2020-09-23 |
| collection_method | A ghost bat was captured using a mist net in open woodland in the vicinity of a known roost. Bat was lured into the mist net using a playback protocol designed by Nicola Hanrahan during her PhD research. Bat was removed from net immediately and placed into a calico bag. The ghost bat was sedated by a trained vet to a workable sedation using isoflourane in a purpose-built chamber. Blood samples were taken using cranial vena cava venepuncture. The fully sedated bat was then euthanised using cervical dislocation. Once the bat was confirmed to be deceased, samples were taken from all identifiable organs, with the number of samples taken based on the size of the organ. |
| collector | Nicola Hanrahan |
| collector_sample_id | PC43 |
| common_name | Ghost Bat |
| country | Australia |
| data_context | Reference Genome |
| data_custodian | Carolyn Hogg |
| data_type | Illumina-HiC |
| dataset_id | 102.100.100/419498 |
| date_of_transfer | 2025-02-10 |
| date_of_transfer_to_archive | 2025-02-11 |
| death_date | 2020-09-23 |
| dna_treatment | FA crosslinking |
| facility_project_code | NA |
| facility_sample_id | 417575_TSI_BRF_22KYTHLT4_CCAAGGTT |
| family | Megadermatidae |
| flowcell_id | 22KYTHLT4 |
| flowcell_type | NovaSeq X 25B |
| folder_name | 20250210_TSI_BRF_419498_22KYTHLT4 |
| genus | Macroderma |
| habitat | Undulating hills, Open Eucalypt woodland, historic gold mining area with multiple mine shafts. |
| health_state | Good |
| insert_size_range | ~600bp |
| institution_name | Charles Darwin University |
| library_construction_protocol | HiC Arima 2.0 |
| library_id | 102.100.100/417575 |
| library_index_id | NEB_Set1_B11 |
| library_index_seq | CCAAGGTT |
| library_layout | Paired end |
| library_location | BRF Freezer |
| library_ng_ul | 1.3 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCAAGGTT(AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 7 |
| library_pcr_reps | 1 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction digest |
| library_source | GENOMIC |
| library_strategy | HiC |
| library_type | illumina-hic |
| lifestage | adult organism |
| location_text | Pine Creek Township, Norhern Territroy |
| material_extracted_by | BRF |
| material_extraction_type | DNA |
| metadata_revision_date | 2026-01-13 |
| metadata_revision_filename | 20260112_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| method_of_determination | genitals |
| n_libraries_pooled | 1 |
| order | Chiroptera |
| phenotypic_sex | male |
| phylum | Chordata |
| prior_genetics | HiFi |
| sample_custodian | Nicola Hanrahan |
| sample_id | 102.100.100/415572 |
| sample_quality | good |
| sample_type | Organ |
| scientific_name | Macroderma gigas |
| scientific_name_authorship | Dobson 1880 |
| sequencing_facility | BRF |
| sequencing_model | NovaSeq X |
| sequencing_platform | Illumina |
| source_population | Pine Creek |
| species | gigas |
| specimen_id | MG_PC43 |
| specimen_id_description | Ghost_bat_HiC genome |
| state_or_region | Northern Territory |
| taxon_id | 9411.0 |
| taxonomic_group | Mammal |
| ticket | BPAOPS-1746 |
| tissue_collection | Charles Darwin University |
| tissue_collection_type | Living collection |
| tissue_number | MG_PC43 |
| tissue_preservation | Liquid Nitrogen - Placed in dry tube,flash frozen in liquid nitrogen, transported on dry ice and stored in -80 freezer |
| tissue_preservation_temperature | -80.0 |
| tissue_type | heart |
| wild_captive | Wild |
| work_order | 14082 |