Ghost Bat, Reference Genome, Illumina-HiC, heart

102.100.100/417575 Macroderma gigas, Australia Northern Territory

Dataset size is: 366.00 Byte

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members
Access Control Date 2026-02-10
Access Control Mode date
Sequence Data Type illumina-hic
access_rights exact site coordinates should not be released to public as it is an important conservation site for ghost bats
ala_specimen_url https://bie.ala.org.au/species/https://biodiversity.org.au/afd/taxa/7993d9b8-c777-41fc-984c-a1fda2c8878f
analysis_software DRAGEN BCLconvert
analysis_software_version 4.1.23
ancillary_notes The captured bat was clearly an older bat with very worn teeth, scarred wing membrane and a large notch missing from his ear.
associated_media photos,videos
base_url https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/genomics-hi-c/BPAOPS-1746/
bioplatforms_project Threatened Species Initiative
ccg_jira_ticket BPAOPS-1746
certainty certain
class Mammalia
collection_date 2020-09-23
collection_method A ghost bat was captured using a mist net in open woodland in the vicinity of a known roost. Bat was lured into the mist net using a playback protocol designed by Nicola Hanrahan during her PhD research. Bat was removed from net immediately and placed into a calico bag. The ghost bat was sedated by a trained vet to a workable sedation using isoflourane in a purpose-built chamber. Blood samples were taken using cranial vena cava venepuncture. The fully sedated bat was then euthanised using cervical dislocation. Once the bat was confirmed to be deceased, samples were taken from all identifiable organs, with the number of samples taken based on the size of the organ.
collector Nicola Hanrahan
collector_sample_id PC43
common_name Ghost Bat
country Australia
data_context Reference Genome
data_custodian Carolyn Hogg
data_type Illumina-HiC
dataset_id 102.100.100/419498
date_of_transfer 2025-02-10
date_of_transfer_to_archive 2025-02-11
death_date 2020-09-23
dna_treatment FA crosslinking
facility_project_code NA
facility_sample_id 417575_TSI_BRF_22KYTHLT4_CCAAGGTT
family Megadermatidae
flowcell_id 22KYTHLT4
flowcell_type NovaSeq X 25B
folder_name 20250210_TSI_BRF_419498_22KYTHLT4
genus Macroderma
habitat Undulating hills, Open Eucalypt woodland, historic gold mining area with multiple mine shafts.
health_state Good
insert_size_range ~600bp
institution_name Charles Darwin University
library_construction_protocol HiC Arima 2.0
library_id 102.100.100/417575
library_index_id NEB_Set1_B11
library_index_seq CCAAGGTT
library_layout Paired end
library_location BRF Freezer
library_ng_ul 1.3
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCAAGGTT(AT)CTCGTATGCCGTCTTCTGCTTG
library_pcr_cycles 7
library_pcr_reps 1
library_prepared_by Max Nekrasov
library_selection Restriction digest
library_source GENOMIC
library_strategy HiC
library_type illumina-hic
lifestage adult organism
location_text Pine Creek Township, Norhern Territroy
material_extracted_by BRF
material_extraction_type DNA
metadata_revision_date 2026-01-13
metadata_revision_filename 20260112_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx
method_of_determination genitals
n_libraries_pooled 1
order Chiroptera
phenotypic_sex male
phylum Chordata
prior_genetics HiFi
sample_custodian Nicola Hanrahan
sample_id 102.100.100/415572
sample_quality good
sample_type Organ
scientific_name Macroderma gigas
scientific_name_authorship Dobson 1880
sequencing_facility BRF
sequencing_model NovaSeq X
sequencing_platform Illumina
source_population Pine Creek
species gigas
specimen_id MG_PC43
specimen_id_description Ghost_bat_HiC genome
state_or_region Northern Territory
taxon_id 9411.0
taxonomic_group Mammal
ticket BPAOPS-1746
tissue_collection Charles Darwin University
tissue_collection_type Living collection
tissue_number MG_PC43
tissue_preservation Liquid Nitrogen - Placed in dry tube,flash frozen in liquid nitrogen, transported on dry ice and stored in -80 freezer
tissue_preservation_temperature -80.0
tissue_type heart
wild_captive Wild
work_order 14082