Orange-bellied Parrot, Population Genetics, Illumina ddRAD-seq, blood on filter paper
Dataset size is: 0.00 Bit
This dataset is currently under a short embargo period until June 11, 2026 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
629192_TSI_AGRF_233JLLLT3_GCCAAT... Metadata Only FASTQ
-
629192_TSI_AGRF_233JLLLT3_CGATGT... Metadata Only FASTQ
-
629192_TSI_AGRF_233JLLLT3_TGACCA... Metadata Only FASTQ
-
629192_TSI_AGRF_233JLLLT3_GTGAAA... Metadata Only FASTQ
-
629192_TSI_AGRF_233JLLLT3_GTGAAA... Metadata Only FASTQ
-
629192_TSI_AGRF_233JLLLT3_ACAGTG... Metadata Only FASTQ
-
629192_TSI_AGRF_233JLLLT3_CGATGT... Metadata Only FASTQ
-
629192_TSI_AGRF_233JLLLT3_CTTGTA... Metadata Only FASTQ
-
629192_TSI_AGRF_233JLLLT3_TGACCA... Metadata Only FASTQ
-
TSI_233JLLLT3_629192_library_met... Metadata Only XLSX
-
629192_TSI_AGRF_233JLLLT3_GCCAAT... Metadata Only FASTQ
-
629192_TSI_AGRF_233JLLLT3_ACAGTG... Metadata Only FASTQ
-
629192_TSI_AGRF_233JLLLT3_CTTGTA... Metadata Only FASTQ
-
TSI_233JLLLT3_629192_samplemetad... Metadata Only XLSX
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2026-06-11 |
| Access Control Mode | date |
| Sequence Data Type | illumina-ddrad |
| Related Data | Attached metadata spreadsheets were produced when data was generated. |
| ala_specimen_url | NA |
| bait_set_name | Restriction Digest |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/ddrad/BPAOPS-1795/20250611_TSI_AGRF_233JLLLT3/ |
| bioplatforms_project | Threatened Species Initiative |
| birth_date | 2021-01-13 |
| bpa_dataset_id | 102.100.100/629192 |
| class | Aves |
| collection_date | 2021-01-01 |
| common_name | Orange-bellied Parrot |
| country | Australia |
| data_context | Population Genetics |
| data_custodian | Soleille Miller |
| data_type | Illumina ddRAD-seq |
| dataset_id | 102.100.100/629192 |
| date_of_transfer | 2025-06-11 |
| date_of_transfer_to_archive | 2025-06-12 |
| experimental_design | PstI/HpyCH4IV |
| facility_project_code | CAGRF25030231 |
| family | Psittaculidae |
| flowcell_id | 233JLLLT3 |
| flowcell_type | 10B |
| folder_name | 20250611_TSI_AGRF_233JLLLT3 |
| genus | Neophema |
| insert_size_range | 280-342 |
| institution_name | AM/USYD/ANU |
| library_construction_protocol | ddRAD (based on Peterson et al 2012) |
| library_layout | paired end |
| library_location | AGRF_Perth |
| library_oligo_sequence | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G |
| library_pcr_cycles | 11.0 |
| library_pcr_reps | 7.0 |
| library_prep_date | 2025-06-02 |
| library_prepared_by | Lachlan Soraru |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | RAD-Seq |
| library_type | ddRAD |
| location_text | Australia, Tasmania, Ex Dpi Captive Breeding Program, Taroona (47� 57' S, 147� 20' E) |
| material_conc_ng_ul | 36.4 |
| material_extracted_by | Kim_Heasman |
| material_extraction_date | 2025-04-15 |
| material_extraction_method | salting out |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-08-26 |
| metadata_revision_filename | 20250826_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| n_libraries_pooled | 6.0 |
| order | Psittaciformes |
| phenotypic_sex | Female |
| phylum | Animalia |
| prior_genetics | NCBI genome accession number GCA_047054915.1, whole genome historical analysis doi:10.1111/mec.17892 |
| sample_custodian | Australian Museum |
| sample_type | tissue |
| scientific_name | Neophema chrysogaster |
| scientific_name_authorship | Latham, 1936 |
| scientific_name_note | first described by Latham as Psittacus chrysogaster, Tommaso Salvadori erected the new genus Neophema in 1891, placing the orange-bellied parrot within it and gave it its current scientific name |
| sequencing_facility | AGRF_Perth |
| sequencing_model | NovaSeq X Plus |
| sequencing_platform | ILLUMINA |
| source_population | wild |
| species | chrysogaster |
| specimen_id | O.84823.001 |
| specimen_id_description | Australian Museum sample registration number |
| state_or_region | Tasmania |
| taxon_id | 678581.0 |
| ticket | BPAOPS-1795 |
| tissue_collection | Australian Museum Frozen Tissue Collection |
| tissue_collection_type | museum |
| tissue_number | AM_84823 |
| tissue_preservation | frozen, dried |
| tissue_preservation_temperature | -80.0 |
| tissue_type | blood on filter paper |
| wild_captive | wild |
| work_order | NA |