Chuditch, Population Genetics, Illumina ddRAD-seq, ear margin
Dataset size is: 0.00 Bit
This dataset is currently under a short embargo period until January 13, 2026 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
358891_TSI_AGRF_22VJF7LT3_ACAGTG... Metadata Only FASTQ
-
358891_TSI_AGRF_22VJF7LT3_CTTGTA... Metadata Only FASTQ
-
358891_TSI_AGRF_22VJF7LT3_CGATGT... Metadata Only FASTQ
-
358891_TSI_AGRF_22VJF7LT3_GTGAAA... Metadata Only FASTQ
-
358891_TSI_AGRF_22VJF7LT3_TGACCA... Metadata Only FASTQ
-
TSI_22VJF7LT3_358891_samplemetad... Metadata Only XLSX
-
TSI_CAGRF24100006_22VJF7LT3_meta... Metadata Only XLSX
-
358891_TSI_AGRF_22VJF7LT3_ACAGTG... Metadata Only FASTQ
-
358891_TSI_AGRF_22VJF7LT3_CGATGT... Metadata Only FASTQ
-
358891_TSI_AGRF_22VJF7LT3_CTTGTA... Metadata Only FASTQ
-
358891_TSI_AGRF_22VJF7LT3_GTGAAA... Metadata Only FASTQ
-
358891_TSI_AGRF_22VJF7LT3_TGACCA... Metadata Only FASTQ
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2026-01-13 |
| Access Control Mode | date |
| Sequence Data Type | illumina-ddrad |
| Related Data | Attached metadata spreadsheets were produced when data was generated. |
| access_rights | Location information restricted |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/ddrad/BPAOPS-1737/20250109_TSI_AGRF_22VJF7LT3/ |
| bioplatforms_project | Threatened Species Initiative |
| bpa_dataset_id | 102.100.100/358891 |
| class | Mammalia |
| collection_date | 2021-06-15 |
| collector | Michelle Drew | DBCA |
| collector_sample_id | 943094320346169.0 |
| common_name | Chuditch |
| country | Australia |
| data_context | Population Genetics |
| data_custodian | Kym Ottewell | DBCA |
| data_type | Illumina ddRAD-seq |
| dataset_id | 102.100.100/358891 |
| date_of_transfer | 2025-01-13 |
| date_of_transfer_to_archive | 2025-01-13 |
| experimental_design | EcoRI/MspI |
| facility_project_code | CAGRF24100006 |
| family | Dasyuridae |
| flowcell_id | 22VJF7LT3 |
| flowcell_type | 10B |
| folder_name | 20250109_TSI_AGRF_22VJF7LT3 |
| genus | Dasyurus |
| insert_size_range | 280-342 bp |
| institution_name | Department of Biodiversity, Conservation and Attractions |
| library_construction_protocol | ddRAD (based on Peterson et al 2012) |
| library_layout | paired end |
| library_location | AGRF_Perth |
| library_oligo_sequence | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G |
| library_pcr_cycles | 11.0 |
| library_pcr_reps | 7.0 |
| library_prep_date | 2024-12-16 |
| library_prepared_by | Jeremy Beerkens |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | RAD-Seq |
| library_type | illumina-ddrad |
| lifestage | unknown |
| location_text | Julimar State Forest |
| material_conc_ng_ul | 10.0 |
| material_extracted_by | Shelley McArthur | DBCA |
| material_extraction_date | 2021-07-27 |
| material_extraction_method | TNES Salt extraction |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-08-26 |
| metadata_revision_filename | 20250826_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| n_libraries_pooled | 5.0 |
| order | Dasyuromorphia |
| phenotypic_sex | M |
| phylum | Chordata |
| sample_custodian | Kym Ottewell | DBCA |
| sample_quality | good |
| sample_type | ear biopsy |
| scientific_name | Dasyurus geoffroii |
| scientific_name_authorship | Gould, 1982 |
| sequencing_facility | AGRF_Melbourne |
| sequencing_model | NovaSeq X Plus |
| sequencing_platform | ILLUMINA |
| source_population | Julimar State Forest |
| species | geoffroii |
| specimen_id | D10978 |
| specimen_id_description | DBCA_internal_identifier |
| state_or_region | Western Australia |
| taxon_id | 63145.0 |
| taxonomic_group | Mammal |
| ticket | BPAOPS-1737 |
| tissue_collection_type | wild organism |
| tissue_number | T10978 |
| tissue_preservation | ethanol |
| tissue_preservation_temperature | -18.0 |
| tissue_type | ear margin |
| wild_captive | wild |
| work_order | 14076 |