Chuditch, Population Genetics, Illumina ddRAD-seq, ear margin
Dataset size is: 0.00 Bit
Data and Resources
-
358891_TSI_AGRF_22VJF7LT3_ACAGTG... Metadata Only FASTQ
-
358891_TSI_AGRF_22VJF7LT3_CTTGTA... Metadata Only FASTQ
-
358891_TSI_AGRF_22VJF7LT3_CGATGT... Metadata Only FASTQ
-
358891_TSI_AGRF_22VJF7LT3_GTGAAA... Metadata Only FASTQ
-
358891_TSI_AGRF_22VJF7LT3_TGACCA... Metadata Only FASTQ
-
TSI_22VJF7LT3_358891_samplemetad... Metadata Only XLSX
-
TSI_CAGRF24100006_22VJF7LT3_meta... Metadata Only XLSX
-
358891_TSI_AGRF_22VJF7LT3_ACAGTG... Metadata Only FASTQ
-
358891_TSI_AGRF_22VJF7LT3_CGATGT... Metadata Only FASTQ
-
358891_TSI_AGRF_22VJF7LT3_CTTGTA... Metadata Only FASTQ
-
358891_TSI_AGRF_22VJF7LT3_GTGAAA... Metadata Only FASTQ
-
358891_TSI_AGRF_22VJF7LT3_TGACCA... Metadata Only FASTQ
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2026-01-13 |
| Access Control Mode | date |
| Sequence Data Type | illumina-ddrad |
| Related Data | Attached metadata spreadsheets were produced when data was generated. |
| access_rights | Location information restricted |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/ddrad/BPAOPS-1737/20250109_TSI_AGRF_22VJF7LT3/ |
| bioplatforms_project | Threatened Species Initiative |
| bpa_dataset_id | 102.100.100/358891 |
| class | Mammalia |
| collection_date | 2021-06-15 |
| collector | Michelle Drew | DBCA |
| collector_sample_id | 943094320346169.0 |
| common_name | Chuditch |
| country | Australia |
| data_context | Population Genetics |
| data_custodian | Kym Ottewell | DBCA |
| data_type | Illumina ddRAD-seq |
| dataset_id | 102.100.100/358891 |
| date_of_transfer | 2025-01-13 |
| date_of_transfer_to_archive | 2025-01-13 |
| experimental_design | EcoRI/MspI |
| facility_project_code | CAGRF24100006 |
| family | Dasyuridae |
| flowcell_id | 22VJF7LT3 |
| flowcell_type | 10B |
| folder_name | 20250109_TSI_AGRF_22VJF7LT3 |
| genus | Dasyurus |
| insert_size_range | 280-342 bp |
| institution_name | Department of Biodiversity, Conservation and Attractions |
| library_construction_protocol | ddRAD (based on Peterson et al 2012) |
| library_layout | paired end |
| library_location | AGRF_Perth |
| library_oligo_sequence | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G |
| library_pcr_cycles | 11.0 |
| library_pcr_reps | 7.0 |
| library_prep_date | 2024-12-16 |
| library_prepared_by | Jeremy Beerkens |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | RAD-Seq |
| library_type | illumina-ddrad |
| lifestage | unknown |
| location_text | Julimar State Forest |
| material_conc_ng_ul | 10.0 |
| material_extracted_by | Shelley McArthur | DBCA |
| material_extraction_date | 2021-07-27 |
| material_extraction_method | TNES Salt extraction |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-08-26 |
| metadata_revision_filename | 20250826_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| n_libraries_pooled | 5.0 |
| order | Dasyuromorphia |
| phenotypic_sex | M |
| phylum | Chordata |
| sample_custodian | Kym Ottewell | DBCA |
| sample_quality | good |
| sample_type | ear biopsy |
| scientific_name | Dasyurus geoffroii |
| scientific_name_authorship | Gould, 1982 |
| sequencing_facility | AGRF_Melbourne |
| sequencing_model | NovaSeq X Plus |
| sequencing_platform | ILLUMINA |
| source_population | Julimar State Forest |
| species | geoffroii |
| specimen_id | D10978 |
| specimen_id_description | DBCA_internal_identifier |
| state_or_region | Western Australia |
| taxon_id | 63145.0 |
| taxonomic_group | Mammal |
| ticket | BPAOPS-1737 |
| tissue_collection_type | wild organism |
| tissue_number | T10978 |
| tissue_preservation | ethanol |
| tissue_preservation_temperature | -18.0 |
| tissue_type | ear margin |
| wild_captive | wild |
| work_order | 14076 |