White's seahorse, Population genetics, Illumina ddRAD-seq, Whole animal
Dataset size is: 0.00 Bit
This dataset is currently under a short embargo period until October 15, 2025 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
358888_TSI_AGRF_22NT53LT3_ACAGTG... Metadata Only FASTQ
-
TSI_CAGRF24030333_22NT53LT3_meta... Metadata Only XLSX
-
358888_TSI_AGRF_22NT53LT3_CTTGTA... Metadata Only FASTQ
-
358888_TSI_AGRF_22NT53LT3_CTTGTA... Metadata Only FASTQ
-
TSI_22NT53LT3_358888_samplemetad... Metadata Only XLSX
-
358888_TSI_AGRF_22NT53LT3_ACAGTG... Metadata Only FASTQ
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Geospatial Coverage |
Dataset extentMap tiles & Data by OpenStreetMap, under CC BY SA.
|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2025-10-15 |
| Access Control Mode | date |
| Sequence Data Type | illumina-ddrad |
| Related Data | Attached metadata spreadsheets were produced when data was generated. |
| access_rights | No restrictions |
| ala_specimen_url | NA |
| ancillary_notes | Born from Sydney Harbour parents |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/ddrad/BPAOPS-1703/20241007_TSI_AGRF_22NT53LT3/ |
| bioplatforms_project | Threatened Species Initiative |
| bpa_dataset_id | 102.100.100/358888 |
| certainty | certain |
| class | Actinopterygii |
| collection_date | 2022-11-09 |
| collector | Mitchell Brennan |
| collector_sample_id | AQ07 |
| common_name | White's seahorse |
| country | Australia |
| data_context | Population genetics |
| data_custodian | Michael Stat |
| data_type | Illumina ddRAD-seq |
| dataset_id | 102.100.100/358888 |
| date_of_transfer | 2024-10-15 |
| date_of_transfer_to_archive | 2024-10-15 |
| death_date | 2022-11-09 |
| decimal_latitude_public | -33.9 |
| decimal_longitude_public | 151.2 |
| experimental_design | EcoRI/HpyCH4IV |
| facility_project_code | CAGRF24030333 |
| family | Syngnathidae |
| flowcell_id | 22NT53LT3 |
| flowcell_type | 10B |
| folder_name | 20241007_TSI_AGRF_22NT53LT3 |
| genotypic_sex | unknown |
| genus | Hippocampus |
| habitat | Sydney Harbour |
| health_state | Dead |
| insert_size_range | Wide: 280 - 375bp |
| institution_name | NSW DPI |
| latitude | -33.9 |
| library_construction_protocol | ddRAD (based on Peterson et al 2012) |
| library_layout | paired end |
| library_location | AGRF_Perth |
| library_oligo_sequence | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G |
| library_pcr_cycles | 11.0 |
| library_pcr_reps | 7.0 |
| library_prep_date | 2024-09-09 |
| library_prepared_by | Jeremy Beerkens |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | RAD-Seq |
| library_type | illumina-ddrad |
| lifestage | Newborn |
| location_text | Sydney Harbour |
| longitude | 151.2 |
| material_conc_ng_ul | 25.0 |
| material_extracted_by | Michael Stat |
| material_extraction_date | 2024-03-21 |
| material_extraction_method | Qiagen Blood & Tissue kit |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-08-26 |
| metadata_revision_filename | 20250826_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| method_of_determination | Presence/absence of pouch |
| n_libraries_pooled | 2.0 |
| order | Syngnathiformes |
| phenotypic_sex | unknown |
| phylum | Chordata |
| prior_genetics | NA |
| sample_custodian | David Harasti |
| sample_quality | Excellent |
| sample_type | tissue sample |
| scientific_name | Hippocampus whitei |
| scientific_name_authorship | Bleeker, 1855 |
| sequencing_facility | AGRF_Melbourne |
| sequencing_model | NovaSeq X Plus |
| sequencing_platform | ILLUMINA |
| source_population | SEALIFE Aquarium |
| species | whitei |
| specimen_id | DNA 1567 |
| specimen_id_description | University of Newcastle Environmental Genomics Lab |
| state_or_region | New South Wales |
| subspecies | NA |
| taxon_id | 109292.0 |
| taxonomic_group | Fish |
| ticket | BPAOPS-1703 |
| tissue_collection | F7 |
| tissue_collection_type | Living collection |
| tissue_number | AQ07 |
| tissue_preservation | Eth transfer to RNA |
| tissue_preservation_temperature | room temp |
| tissue_type | Whole animal |
| wild_captive | Captive |
| work_order | 14066 |