White's seahorse, Population genetics, Illumina ddRAD-seq, Whole animal
Dataset size is: 0.00 Bit
Data and Resources
-
358888_TSI_AGRF_22NT53LT3_ACAGTG... Metadata Only FASTQ
-
TSI_CAGRF24030333_22NT53LT3_meta... Metadata Only XLSX
-
358888_TSI_AGRF_22NT53LT3_CTTGTA... Metadata Only FASTQ
-
358888_TSI_AGRF_22NT53LT3_CTTGTA... Metadata Only FASTQ
-
TSI_22NT53LT3_358888_samplemetad... Metadata Only XLSX
-
358888_TSI_AGRF_22NT53LT3_ACAGTG... Metadata Only FASTQ
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Geospatial Coverage |
Dataset extent |
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2025-10-15 |
| Access Control Mode | date |
| Sequence Data Type | illumina-ddrad |
| Related Data | Attached metadata spreadsheets were produced when data was generated. |
| access_rights | No restrictions |
| ala_specimen_url | NA |
| ancillary_notes | Born from Sydney Harbour parents |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/ddrad/BPAOPS-1703/20241007_TSI_AGRF_22NT53LT3/ |
| bioplatforms_project | Threatened Species Initiative |
| bpa_dataset_id | 102.100.100/358888 |
| certainty | certain |
| class | Actinopterygii |
| collection_date | 2022-11-09 |
| collector | Mitchell Brennan |
| collector_sample_id | AQ07 |
| common_name | White's seahorse |
| country | Australia |
| data_context | Population genetics |
| data_custodian | Michael Stat |
| data_type | Illumina ddRAD-seq |
| dataset_id | 102.100.100/358888 |
| date_of_transfer | 2024-10-15 |
| date_of_transfer_to_archive | 2024-10-15 |
| death_date | 2022-11-09 |
| decimal_latitude_public | -33.9 |
| decimal_longitude_public | 151.2 |
| experimental_design | EcoRI/HpyCH4IV |
| facility_project_code | CAGRF24030333 |
| family | Syngnathidae |
| flowcell_id | 22NT53LT3 |
| flowcell_type | 10B |
| folder_name | 20241007_TSI_AGRF_22NT53LT3 |
| genotypic_sex | unknown |
| genus | Hippocampus |
| habitat | Sydney Harbour |
| health_state | Dead |
| insert_size_range | Wide: 280 - 375bp |
| institution_name | NSW DPI |
| latitude | -33.9 |
| library_construction_protocol | ddRAD (based on Peterson et al 2012) |
| library_layout | paired end |
| library_location | AGRF_Perth |
| library_oligo_sequence | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G |
| library_pcr_cycles | 11.0 |
| library_pcr_reps | 7.0 |
| library_prep_date | 2024-09-09 |
| library_prepared_by | Jeremy Beerkens |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | RAD-Seq |
| library_type | illumina-ddrad |
| lifestage | Newborn |
| location_text | Sydney Harbour |
| longitude | 151.2 |
| material_conc_ng_ul | 25.0 |
| material_extracted_by | Michael Stat |
| material_extraction_date | 2024-03-21 |
| material_extraction_method | Qiagen Blood & Tissue kit |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-08-26 |
| metadata_revision_filename | 20250826_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| method_of_determination | Presence/absence of pouch |
| n_libraries_pooled | 2.0 |
| order | Syngnathiformes |
| phenotypic_sex | unknown |
| phylum | Chordata |
| prior_genetics | NA |
| sample_custodian | David Harasti |
| sample_quality | Excellent |
| sample_type | tissue sample |
| scientific_name | Hippocampus whitei |
| scientific_name_authorship | Bleeker, 1855 |
| sequencing_facility | AGRF_Melbourne |
| sequencing_model | NovaSeq X Plus |
| sequencing_platform | ILLUMINA |
| source_population | SEALIFE Aquarium |
| species | whitei |
| specimen_id | DNA 1567 |
| specimen_id_description | University of Newcastle Environmental Genomics Lab |
| state_or_region | New South Wales |
| subspecies | NA |
| taxon_id | 109292.0 |
| taxonomic_group | Fish |
| ticket | BPAOPS-1703 |
| tissue_collection | F7 |
| tissue_collection_type | Living collection |
| tissue_number | AQ07 |
| tissue_preservation | Eth transfer to RNA |
| tissue_preservation_temperature | room temp |
| tissue_type | Whole animal |
| wild_captive | Captive |
| work_order | 14066 |