Population Genetics, Illumina ddRAD-seq, leaf
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2025-09-27 |
| Access Control Mode | date |
| Sequence Data Type | illumina-ddrad |
| Related Data | Attached metadata spreadsheets were produced when data was generated. |
| access_rights | No restrictions |
| ala_specimen_url | NA |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/ddrad/BPAOPS-1691/20240924_TSI_AGRF_22T3HWLT3/ |
| bioplatforms_project | Threatened Species Initiative |
| bpa_dataset_id | 102.100.100/358885 |
| certainty | not determined |
| collector | Laurence Haegi |
| collector_sample_id | Hr haegi 1391 |
| country | Australia |
| data_context | Population Genetics |
| data_custodian | Korjent van Dijk |
| data_type | Illumina ddRAD-seq |
| dataset_id | 102.100.100/358885 |
| date_of_transfer | 2024-09-27 |
| date_of_transfer_to_archive | 2024-09-27 |
| experimental_design | PstI/NlaIII |
| facility_project_code | CAGRF24060065 |
| family | Proteaceae |
| flowcell_id | 22T3HWLT3 |
| flowcell_type | 10B |
| folder_name | 20240924_TSI_AGRF_22T3HWLT3 |
| genotypic_sex | not determined |
| genus | Hakea |
| health_state | unknown |
| insert_size_range | Narrow 280-342 |
| institution_name | State Herbarium of South Australia |
| library_construction_protocol | ddRAD (based on Peterson et al 2012) |
| library_index_id_dual | PP7i4 |
| library_index_seq_dual | TGACCA |
| library_layout | paired end |
| library_location | AGRF_Perth |
| library_ng_ul | 7.64 |
| library_oligo_sequence | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G |
| library_oligo_sequence_dual | CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTG*C |
| library_pcr_cycles | 11.0 |
| library_pcr_reps | 7.0 |
| library_prep_date | 2024-09-24 |
| library_prepared_by | Jeremy Beerkens |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | RAD-Seq |
| library_type | illumina-ddrad |
| lifestage | unknown |
| location_text | S. Aust., South East. 4.4 km S of N boundary of Gum Lagoon C.P. |
| material_conc_ng_ul | 52.0 |
| material_extracted_by | University of Adelaide |
| material_extraction_date | 2024-03-27 |
| material_extraction_method | Qiagen column |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-08-26 |
| metadata_revision_filename | 20250826_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| method_of_determination | not determined |
| n_libraries_pooled | 1.0 |
| order | Proteales |
| phenotypic_sex | not determined |
| phylum | Magnoliophyta |
| prior_genetics | NA |
| sample_custodian | Laurence Haegi |
| sample_type | tissue sample |
| scientific_name | Hakea repullulans |
| scientific_name_authorship | Lee, 1984 |
| sequencing_facility | AGRF_Melbourne |
| sequencing_model | NovaSeq X Plus |
| sequencing_platform | ILLUMINA |
| species | repullulans |
| specimen_id | Hr haegi 1391 |
| specimen_id_description | Personal collection number R. Davies |
| state_or_region | South Australia |
| taxonomic_group | plant |
| ticket | BPAOPS-1691 |
| tissue_collection | Kangaroo Island |
| tissue_collection_type | wild population |
| tissue_number | R. Davies 1391 |
| tissue_preservation | silica gel |
| tissue_preservation_temperature | Room temperature |
| tissue_type | leaf |
| wild_captive | wild |
| work_order | 14072 |