Population Genetics, Illumina ddRAD-seq, leaf

Proteaceae, Hakea repullulans, Hr haegi 1391, plant, Project Lead: Korjent van Dijk

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members
Access Control Date 2025-09-27
Access Control Mode date
Sequence Data Type illumina-ddrad
Related Data Attached metadata spreadsheets were produced when data was generated.
access_rights No restrictions
ala_specimen_url NA
ancillary_notes NA
associated_media NA
barcode_id NA
base_url https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/ddrad/BPAOPS-1691/20240924_TSI_AGRF_22T3HWLT3/
bioplatforms_project Threatened Species Initiative
bpa_dataset_id 102.100.100/358885
certainty not determined
collector Laurence Haegi
collector_sample_id Hr haegi 1391
country Australia
data_context Population Genetics
data_custodian Korjent van Dijk
data_type Illumina ddRAD-seq
dataset_id 102.100.100/358885
date_of_transfer 2024-09-27
date_of_transfer_to_archive 2024-09-27
experimental_design PstI/NlaIII
facility_project_code CAGRF24060065
family Proteaceae
flowcell_id 22T3HWLT3
flowcell_type 10B
folder_name 20240924_TSI_AGRF_22T3HWLT3
genotypic_sex not determined
genus Hakea
health_state unknown
insert_size_range Narrow 280-342
institution_name State Herbarium of South Australia
library_construction_protocol ddRAD (based on Peterson et al 2012)
library_index_id_dual PP7i4
library_index_seq_dual TGACCA
library_layout paired end
library_location AGRF_Perth
library_ng_ul 7.64
library_oligo_sequence AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G
library_oligo_sequence_dual CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTG*C
library_pcr_cycles 11.0
library_pcr_reps 7.0
library_prep_date 2024-09-24
library_prepared_by Jeremy Beerkens
library_selection Restriction Digest
library_source GENOMIC
library_strategy RAD-Seq
library_type illumina-ddrad
lifestage unknown
location_text S. Aust., South East. 4.4 km S of N boundary of Gum Lagoon C.P.
material_conc_ng_ul 52.0
material_extracted_by University of Adelaide
material_extraction_date 2024-03-27
material_extraction_method Qiagen column
material_extraction_type DNA
metadata_revision_date 2025-08-26
metadata_revision_filename 20250826_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx
method_of_determination not determined
n_libraries_pooled 1.0
order Proteales
phenotypic_sex not determined
phylum Magnoliophyta
prior_genetics NA
sample_custodian Laurence Haegi
sample_type tissue sample
scientific_name Hakea repullulans
scientific_name_authorship Lee, 1984
sequencing_facility AGRF_Melbourne
sequencing_model NovaSeq X Plus
sequencing_platform ILLUMINA
species repullulans
specimen_id Hr haegi 1391
specimen_id_description Personal collection number R. Davies
state_or_region South Australia
taxonomic_group plant
ticket BPAOPS-1691
tissue_collection Kangaroo Island
tissue_collection_type wild population
tissue_number R. Davies 1391
tissue_preservation silica gel
tissue_preservation_temperature Room temperature
tissue_type leaf
wild_captive wild
work_order 14072