Population Genetics, Illumina ddRAD-seq, leaf
Dataset size is: 0.00 Bit
Data and Resources
-
358873_TSI_AGRF_22NTFWLT3_TGACCA... Metadata Only FASTQ
-
358873_TSI_AGRF_22NTFWLT3_ACAGTG... Metadata Only FASTQ
-
358873_TSI_AGRF_22NTFWLT3_TGACCA... Metadata Only FASTQ
-
TSI_22NTFWLT3_358873_samplemetad... Metadata Only XLSX
-
TSI_CAGRF24030106_22NTFWLT3_meta... Metadata Only XLSX
-
358873_TSI_AGRF_22NTFWLT3_ACAGTG... Metadata Only FASTQ
-
358873_TSI_AGRF_22NTFWLT3_CTTGTA... Metadata Only FASTQ
-
358873_TSI_AGRF_22NTFWLT3_GTGAAA... Metadata Only FASTQ
-
358873_TSI_AGRF_22NTFWLT3_GTGAAA... Metadata Only FASTQ
-
358873_TSI_AGRF_22NTFWLT3_CTTGTA... Metadata Only FASTQ
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2025-10-10 |
| Access Control Mode | date |
| Sequence Data Type | illumina-ddrad |
| Related Data | Attached metadata spreadsheets were produced when data was generated. |
| access_rights | No restrictions |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/ddrad/BPAOPS-1702/20241007_TSI_AGRF_22NTFWLT3/ |
| bioplatforms_project | Threatened Species Initiative |
| bpa_dataset_id | 102.100.100/358873 |
| collection_date | 2023-08-24 |
| collector | Catherine Nano, Debbie Randall, Peter Mcdonald |
| collector_sample_id | NDH4_a |
| country | Australia |
| data_context | Population Genetics |
| data_custodian | Caroline Chong |
| data_type | Illumina ddRAD-seq |
| dataset_id | 102.100.100/358873 |
| date_of_transfer | 2024-10-10 |
| date_of_transfer_to_archive | 2024-10-11 |
| facility_project_code | CAGRF24030106 |
| family | Fabaceae |
| flowcell_id | 22NTFWLT3 |
| flowcell_type | 10B |
| folder_name | 20241007_TSI_AGRF_22NTFWLT3 |
| genus | Acacia |
| habitat | predominantly on steep south-facing slopes of rocky sandstone or quartzite ramges with skeletal acid soils |
| insert_size_range | Narrow - 280 - 342 bp |
| institution_name | Northern Territory Herbarium |
| library_construction_protocol | ddRAD (based on Peterson et al 2012) |
| library_layout | paired end |
| library_location | AGRF_Perth |
| library_oligo_sequence | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G |
| library_pcr_cycles | 11.0 |
| library_pcr_reps | 7.0 |
| library_prep_date | 2024-09-24 |
| library_prepared_by | Jeremy Beerkens |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | RAD-Seq |
| library_type | Illumina-ddRAD |
| location_text | Ndhala Gorge Nature Park |
| material_conc_ng_ul | 20.0 |
| material_extracted_by | University of Adelaide |
| material_extraction_method | Qiagen column |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-08-26 |
| metadata_revision_filename | 20250826_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| n_libraries_pooled | 4.0 |
| order | Fabales |
| phylum | Magnoliophyta |
| sample_custodian | Caroline Chong |
| sample_type | tissue sample |
| scientific_name | Acacia undoolyana |
| scientific_name_authorship | Leach, 1988 |
| sequencing_facility | AGRF_Melbourne |
| sequencing_model | NovaSeq X Plus |
| sequencing_platform | ILLUMINA |
| species | undoolyana |
| specimen_id | DNA_NDH4_a |
| specimen_id_description | Northern Territory Herbarium interim record number |
| state_or_region | Northern Territory |
| taxon_id | 1174914.0 |
| taxonomic_group | plant |
| ticket | BPAOPS-1702 |
| tissue_collection | NTG_MacDonnell Ranges |
| tissue_collection_type | wild population |
| tissue_number | DNA_NDH4_a_tissue sample |
| tissue_preservation | silica gel |
| tissue_type | leaf |
| wild_captive | wild |
| work_order | 14062 |