Population Genetics, Illumina ddRAD-seq, leaf

Fabaceae, Acacia undoolyana, DNA_NDH4_a, plant, Project Lead: Caroline Chong

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members
Access Control Date 2025-10-10
Access Control Mode date
Sequence Data Type illumina-ddrad
Related Data Attached metadata spreadsheets were produced when data was generated.
access_rights No restrictions
base_url https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/ddrad/BPAOPS-1702/20241007_TSI_AGRF_22NTFWLT3/
bioplatforms_project Threatened Species Initiative
bpa_dataset_id 102.100.100/358873
collection_date 2023-08-24
collector Catherine Nano, Debbie Randall, Peter Mcdonald
collector_sample_id NDH4_a
country Australia
data_context Population Genetics
data_custodian Caroline Chong
data_type Illumina ddRAD-seq
dataset_id 102.100.100/358873
date_of_transfer 2024-10-10
date_of_transfer_to_archive 2024-10-11
facility_project_code CAGRF24030106
family Fabaceae
flowcell_id 22NTFWLT3
flowcell_type 10B
folder_name 20241007_TSI_AGRF_22NTFWLT3
genus Acacia
habitat predominantly on steep south-facing slopes of rocky sandstone or quartzite ramges with skeletal acid soils
insert_size_range Narrow - 280 - 342 bp
institution_name Northern Territory Herbarium
library_construction_protocol ddRAD (based on Peterson et al 2012)
library_layout paired end
library_location AGRF_Perth
library_oligo_sequence AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G
library_pcr_cycles 11.0
library_pcr_reps 7.0
library_prep_date 2024-09-24
library_prepared_by Jeremy Beerkens
library_selection Restriction Digest
library_source GENOMIC
library_strategy RAD-Seq
library_type Illumina-ddRAD
location_text Ndhala Gorge Nature Park
material_conc_ng_ul 20.0
material_extracted_by University of Adelaide
material_extraction_method Qiagen column
material_extraction_type DNA
metadata_revision_date 2025-08-26
metadata_revision_filename 20250826_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx
n_libraries_pooled 4.0
order Fabales
phylum Magnoliophyta
sample_custodian Caroline Chong
sample_type tissue sample
scientific_name Acacia undoolyana
scientific_name_authorship Leach, 1988
sequencing_facility AGRF_Melbourne
sequencing_model NovaSeq X Plus
sequencing_platform ILLUMINA
species undoolyana
specimen_id DNA_NDH4_a
specimen_id_description Northern Territory Herbarium interim record number
state_or_region Northern Territory
taxon_id 1174914.0
taxonomic_group plant
ticket BPAOPS-1702
tissue_collection NTG_MacDonnell Ranges
tissue_collection_type wild population
tissue_number DNA_NDH4_a_tissue sample
tissue_preservation silica gel
tissue_type leaf
wild_captive wild
work_order 14062