waddy, Population Genetics, Illumina FASTQ, Phyllode sample
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Geospatial Coverage |
Dataset extent |
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2025-04-19 |
| Access Control Mode | date |
| Sequence Data Type | illumina-ddrad |
| Related Data | Attached metadata spreadsheets were produced when data was generated. |
| access_rights | Location information restricted |
| ala_specimen_url | NA |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/ddrad/BPAOPS-1576/20240306_TSI_AGRF_22JM2GLT3/ |
| bioplatforms_project | Threatened Species Initiative |
| bpa_dataset_id | 102.100.100/358847 |
| class | Magnoliopsida |
| collection_date | 2014-01-01 |
| collector | John Luly |
| common_name | waddy |
| country | Australia |
| data_context | Population Genetics |
| data_custodian | Korjent van Dijk |
| data_type | Illumina FASTQ |
| dataset_id | 102.100.100/358847 |
| date_of_transfer | 2024-04-19 |
| date_of_transfer_to_archive | 2024-04-22 |
| decimal_latitude_public | -25.5 |
| decimal_longitude_public | 139.2 |
| description | Illumina ddRAD-seq |
| experimental_design | EcoRI/NlaIII |
| facility_project_code | CAGRF230313975 |
| family | Fabaceae |
| flowcell_id | 22JM2GLT3 |
| flowcell_type | 10B |
| folder_name | 20240306_TSI_AGRF_22JM2GLT3 |
| genus | Acacia |
| health_state | unknown |
| insert_size_range | 280 - 375 (Wide) |
| institution_name | University of Adelaide |
| latitude | -25.5 |
| library_construction_protocol | ddRAD (based on Peterson et al 2012) |
| library_index_id_dual | PP7i12 |
| library_index_seq_dual | CTTGTA |
| library_layout | paired end |
| library_location | AGRF_Perth |
| library_ng_ul | 3.14 |
| library_oligo_sequence | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G |
| library_oligo_sequence_dual | CAAGCAGAAGACGGCATACGAGAtTACAAGGTGACTGGAGTTCAGACGTGTG*C |
| library_pcr_cycles | 11.0 |
| library_pcr_reps | 7.0 |
| library_prep_date | 2024-02-26 |
| library_prepared_by | Jeremy Beerkens |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | RAD-Seq |
| library_type | ddRAD |
| lifestage | unknown |
| location_text | Site G |
| longitude | 139.2 |
| material_conc_ng_ul | unknown |
| material_extracted_by | Jessica Burdon |
| material_extraction_date | 2018-05-03 |
| material_extraction_method | Qiagen Plant Mini Kit |
| metadata_revision_date | 2025-08-26 |
| metadata_revision_filename | 20250826_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| n_libraries_pooled | 1.0 |
| order | Fabales |
| phenotypic_sex | monoecious |
| phylum | Magnoliophyta |
| prior_genetics | NA |
| sample_custodian | Michelle Waycott |
| sample_quality | Some DNA degradation |
| sample_type | tissue sample |
| scientific_name | Acacia peuce |
| scientific_name_authorship | F.Muell. |
| sequencing_facility | AGRF_Melbourne |
| sequencing_model | NovaSeq X Plus |
| sequencing_platform | ILLUMINA |
| source_population | Birdsville |
| species | peuce |
| specimen_id | Gandison_12 |
| specimen_id_description | Uni_Adl_Waycot_Lab |
| state_or_region | Queensland |
| taxon_id | 1174866.0 |
| taxonomic_group | Plant |
| ticket | BPAOPS-1576 |
| tissue_collection | Waycott_Lab |
| tissue_collection_type | university, private |
| tissue_number | Gandison_12 |
| tissue_preservation | Dry Silica Gel |
| tissue_preservation_temperature | Room Temp |
| tissue_type | Phyllode sample |
| type_status | unknown |
| wild_captive | wild |
| work_order | 14047 |