Swan galaxias, Population Genetics, Illumina ddRAD-seq, Fin
Dataset size is: 0.00 Bit
Data and Resources
-
358844_TSI_AGRF_22MN5JLT3_TGACCA... Metadata Only FASTQ
-
358844_TSI_AGRF_22MN5JLT3_TGACCA... Metadata Only FASTQ
-
358844_TSI_AGRF_22MN5JLT3_CGATGT... Metadata Only FASTQ
-
TSI_AGRF_CAGRF23081329_22MN5JLT3... Metadata Only XLSX
-
358844_TSI_AGRF_22MN5JLT3_CGATGT... Metadata Only FASTQ
-
TSI_22MN5JLT3_358844_samplemetad... Metadata Only XLSX
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Geospatial Coverage |
Dataset extent |
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2025-08-01 |
| Access Control Mode | date |
| Sequence Data Type | illumina-ddrad |
| Related Data | Attached metadata spreadsheets were produced when data was generated. |
| access_rights | No restrictions |
| ala_specimen_url | NA |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/ddrad/BPAOPS-1631/20240729_TSI_AGRF_22MN5JLT3/ |
| bioplatforms_project | Threatened Species Initiative |
| bpa_dataset_id | 102.100.100/358844 |
| certainty | not determined |
| class | Actinopterygii |
| collection_date | 2024-01-16 |
| collection_method | Electrofishing |
| collector | Rob Freeman, Bruce Deagle |
| common_name | Swan galaxias |
| country | Australia |
| data_context | Population Genetics |
| data_custodian | Charlotte Jensen |
| data_type | Illumina ddRAD-seq |
| dataset_id | 102.100.100/358844 |
| date_of_transfer | 2024-08-01 |
| date_of_transfer_to_archive | 2024-08-02 |
| death_date | 2024-01-16 |
| decimal_latitude_public | 41.8 |
| decimal_longitude_public | 148.1 |
| description | Galaxias ddRAD |
| experimental_design | PstI/MseI |
| family | Galaxiidae |
| flowcell_id | 22MN5JLT3 |
| flowcell_type | 10B |
| folder_name | 20240729_TSI_AGRF_22MN5JLT3 |
| genotypic_sex | not determined |
| genus | Galaxias |
| habitat | River |
| health_state | unknown |
| insert_size_range | 280-342bp |
| institution_name | CSIRO |
| latitude | 41.8 |
| library_construction_protocol | ddRAD (based on Peterson et al 2012) |
| library_layout | paired end |
| library_location | AGRF_Perth |
| library_oligo_sequence | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G |
| library_pcr_cycles | 11.0 |
| library_pcr_reps | 7.0 |
| library_prep_date | 2024-07-12 |
| library_prepared_by | Daniel Brescianini |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | RAD-Seq |
| library_type | Illumina-ddRAD |
| lifestage | unknown |
| location_text | St. Pauls River (above Meadstone Falls) |
| longitude | 148.1 |
| material_conc_ng_ul | unknown |
| material_extracted_by | Charlotte Jense |
| material_extraction_method | Dneasy Blood & Tissue kit |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-08-26 |
| metadata_revision_filename | 20250826_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| method_of_determination | not determined |
| n_libraries_pooled | 2.0 |
| order | Galaxiiformes |
| phenotypic_sex | not determined |
| phylum | Chordata |
| prior_genetics | NA |
| sample_custodian | Bruce Deagle |
| sample_type | Tissue sample, whole organism |
| scientific_name | Galaxias fontanus |
| scientific_name_authorship | Fulton, 1978 |
| sequencing_facility | AGRF_Melbourne |
| sequencing_model | NovaSeq X Plus |
| sequencing_platform | ILLUMINA |
| source_population | St. Pauls river |
| species | fontanus |
| specimen_id | GF4_2024 |
| specimen_id_description | Created by researcher as followes: the 2 letters correspond with the species name Galaxias brevipinnis and the number is unique for each sample |
| state_or_region | Tasmania |
| taxon_id | 66448.0 |
| taxonomic_group | Fish |
| ticket | BPAOPS-1631 |
| tissue_collection | CSIRO National Fish Collection |
| tissue_number | GF4_2024 |
| tissue_preservation | Ethanol, +4C |
| tissue_preservation_temperature | 4.0 |
| tissue_type | Fin |
| type_status | unknown |
| wild_captive | wild |
| work_order | 14056 |