Plant Pathogen, Genomics, PacBio HiFi, Sample ID 396014
Dataset size is: 0.00 b
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:pp-prj046 |
| Access Control Date | 2026-06-17 |
| Access Control Mode | date |
| Sequence Data Type | pacbio-hifi |
| analysis_software | 25.1.0.257715 |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/pp_staging/pacbio-hifi/BPAOPS-1797/20250606_PP_BRF_m84118_250606_030322_s1/ |
| bioplatforms_dataset_id | 102.100.100/399073 |
| bioplatforms_library_id | 102.100.100/398415 |
| bioplatforms_project | Plant Pathogen Initiative |
| bioplatforms_project_code | PP046_Meloidogyne |
| bioplatforms_sample_id | 102.100.100/396014 |
| ccg_jira_ticket | BPAOPS-1797 |
| cell_postion | A01 |
| class | Chromadorea |
| collection_date | 2024-11-25 |
| collector | Yennefer, A. |
| common_name | Sugarcane eelworm |
| country | Australia |
| data_context | Genomics |
| data_type | PacBio-HiFi |
| date_data_published | 24/6/2025 |
| date_of_transfer | 2025-06-17 |
| date_of_transfer_to_archive | 2025-06-18 |
| decimal_latitude_public | -27.49 |
| decimal_longitude_public | 153.02 |
| description | PacBio-HiFi |
| dna_treatment | Samples concentrated with beads prior prep |
| download | https://data.bioplatforms.com/dataset/?ext_search_by=&q=ticket%3ABPAOPS-1797 |
| experimental_design | PCR adapter sequence AAGCAGTGGTATCAACGCAGAGTACT |
| facility | BRF |
| facility_sample_id | 927-3 |
| family | Meloidogynidae |
| flowcell_id | m84118_250606_030322_s1 |
| flowcell_type | SMRT Cell 25M |
| folder_name | 20250606_PP_BRF_m84118_250606_030322_s1 |
| genus | Meloidogyne |
| host_common_name | Tomato |
| host_family | Solanaceae |
| host_organ | Root |
| host_scientific_name | Solanum lycopersicum |
| host_status | Research culture |
| host_symptom | Galling |
| insert_size_range | 9998.0 |
| library_construction_protocol | PacBio ultra low input |
| library_id | 398415 |
| library_index_id_dual | bc2039 |
| library_index_seq_dual | CATGTATGTCGAGTAT |
| library_layout | NA |
| library_location | BRF labs |
| library_ng_ul | 52.6 |
| library_pcr_cycles | 10 |
| library_pcr_reps | 1 |
| library_prep_date | 2025-06-05 |
| library_prepared_by | Xiangning Liu |
| library_selection | random |
| library_source | genomic |
| library_strategy | WGA |
| library_type | PacBio-HiFi |
| life_stage | Adult |
| location_text | Ecosciences Precinct, Brisbane, Queensland Department of Agriculture and Fisheries |
| material_extracted_by | Avalon Yennefer | CISRO |
| material_extraction_date | 2024-11-26 |
| material_extraction_method | Qiagen tip 20/G kit |
| material_extraction_type | gDNA |
| metadata_revision_date | 2025-06-20 |
| metadata_revision_filename | 2025-04-08_Combined_Plant_Pathogen_sample_metadata_forQCIF_removelatlong.xlsx |
| movie_length | 30h |
| n_libraries_pooled | 4.0 |
| order | Rhabditida |
| phylum | Nematoda |
| project_lead | Daniel Huston | CSIRO |
| sample_collection_type | Ethanol |
| sample_custodian | Daniel Huston | CSIRO, ANIC |
| sample_id | 396014 |
| sample_type | Infested roots |
| scientific_name | Meloidogyne javanica |
| scientific_name_authorship | (Treub, 1885) Chitwood, 1949 |
| sequencing_facility | Biomolecular Research Facility - ANU |
| sequencing_kit_chemistry_version | SPRQ |
| sequencing_model | PacBio Revio |
| sequencing_platform | PacBio |
| species | javanica |
| specimen_custodian | CSIRO Australian National Insect Collection (ANIC); Nematology Section (Nema) |
| specimen_id | ANIC NEMA eth 19871 |
| specimen_id_description | Australian National Insect Collection; Nematology ethanol collection |
| state_or_region | Queensland |
| taxon_id | 6303 |
| taxonomic_group | Nematode |
| ticket | BPAOPS-1797 |