Plant Pathogen, Genomics, PacBio HiFi, Sample ID 396013

Meloidogyne incognita, Daniel Huston | CSIRO

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:pp-prj046
Access Control Date 2026-06-17
Access Control Mode date
Sequence Data Type pacbio-hifi
analysis_software 25.1.0.257715
base_url https://downloads-qcif.bioplatforms.com/bpa/pp_staging/pacbio-hifi/BPAOPS-1797/20250606_PP_BRF_m84118_250606_030322_s1/
bioplatforms_dataset_id 102.100.100/399073
bioplatforms_library_id 102.100.100/398414
bioplatforms_project Plant Pathogen Initiative
bioplatforms_project_code PP046_Meloidogyne
bioplatforms_sample_id 102.100.100/396013
ccg_jira_ticket BPAOPS-1797
cell_postion A01
class Chromadorea
collection_date 2024-11-25
collector Yennefer, A.
common_name Southern root knot nematode
country Australia
data_context Genomics
data_type PacBio-HiFi
date_data_published 24/6/2025
date_of_transfer 2025-06-17
date_of_transfer_to_archive 2025-06-18
decimal_latitude_public -27.49
decimal_longitude_public 153.02
description PacBio-HiFi
dna_treatment Samples concentrated with beads prior prep
download https://data.bioplatforms.com/dataset/?ext_search_by=&q=ticket%3ABPAOPS-1797
experimental_design PCR adapter sequence AAGCAGTGGTATCAACGCAGAGTACT
facility BRF
facility_sample_id 927-2
family Meloidogynidae
flowcell_id m84118_250606_030322_s1
flowcell_type SMRT Cell 25M
folder_name 20250606_PP_BRF_m84118_250606_030322_s1
genus Meloidogyne
host_common_name Tomato
host_family Solanaceae
host_organ Root
host_scientific_name Solanum lycopersicum
host_status Research culture
host_symptom Galling
insert_size_range 9998.0
library_construction_protocol PacBio ultra low input
library_id 398414
library_index_id_dual bc2038
library_index_seq_dual TCACGACGACGAGTAT
library_layout NA
library_location BRF labs
library_ng_ul 52.6
library_pcr_cycles 10
library_pcr_reps 1
library_prep_date 2025-06-05
library_prepared_by Xiangning Liu
library_selection random
library_source genomic
library_strategy WGA
library_type PacBio-HiFi
life_stage Adult
location_text Ecosciences Precinct, Brisbane, Queensland Department of Agriculture and Fisheries
material_extracted_by Avalon Yennefer | CISRO
material_extraction_date 2024-11-26
material_extraction_method Qiagen tip 20/G kit
material_extraction_type gDNA
metadata_revision_date 2025-06-20
metadata_revision_filename 2025-04-08_Combined_Plant_Pathogen_sample_metadata_forQCIF_removelatlong.xlsx
movie_length 30h
n_libraries_pooled 4.0
order Rhabditida
phylum Nematoda
project_lead Daniel Huston | CSIRO
sample_collection_type Ethanol
sample_custodian Daniel Huston | CSIRO, ANIC
sample_id 396013
sample_type Infested roots
scientific_name Meloidogyne incognita
scientific_name_authorship (Kofoid & White, 1919) Chitwood, 1949
sequencing_facility Biomolecular Research Facility - ANU
sequencing_kit_chemistry_version SPRQ
sequencing_model PacBio Revio
sequencing_platform PacBio
species incognita
specimen_custodian CSIRO Australian National Insect Collection (ANIC); Nematology Section (Nema)
specimen_id ANIC NEMA eth 19870
specimen_id_description Australian National Insect Collection; Nematology ethanol collection
state_or_region Queensland
taxon_id 6306
taxonomic_group Nematode
ticket BPAOPS-1797