Plant Pathogen, Genomics, PromethION, Sample ID 395665
Dataset size is: 0.00 Bit
Data and Resources
-
395665_LibID398320_PP_BRF_PAS147... Metadata Only TAR
-
PP_BRF_PAS14798_ONTPromethION_pod5.tar Metadata Only TAR
Optional
-
PP_BRF_PAS14798_ONTPromethION_se... Metadata Only
-
PP_BRF_PAS14798_ONTPromethION_re... Metadata Only HTML
-
PP_BRF_PAS14798_ONTPromethION_ba... Metadata Only
-
395665_LibID398320_PP_BRF_PAS147... Metadata Only TAR
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:pp-prj044 |
| Access Control Date | 2025-08-15 |
| Access Control Mode | date |
| Sequence Data Type | ont-promethion |
| analysis_software | MinKNOW 24.02.19 |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/pp_staging/ont-promethion/BPAOPS-1645/20240802_PP_BRF_PAS14798/ |
| bioplatforms_dataset_id | 102.100.100/399066 |
| bioplatforms_library_id | 102.100.100/398320 |
| bioplatforms_project | Plant Pathogen Initiative |
| bioplatforms_project_code | PP044_Puccinia_2 |
| bioplatforms_sample_id | 102.100.100/395665 |
| ccg_jira_ticket | BPAOPS-1645 |
| cell_postion | 3B |
| class | Pucciniomycetes |
| common_name | Stripe rust fungus |
| country | Australia |
| data_context | Genomics |
| data_type | ONT |
| date_data_published | 20/08/2024 |
| date_of_transfer | 2024-08-15 |
| date_of_transfer_to_archive | 2024-08-16 |
| description | PromethION - dataset 10 |
| dna_treatment | 2nd strand cDNA synthesis from poly-A enriched DNA, direct cDNA synthesis, no PCRs |
| download | https://data.bioplatforms.com/dataset/?ext_search_by=&q=ticket%3ABPAOPS-1645 |
| facility | BRF |
| facility_sample_id | ONT_Lib6_683-8 |
| family | Pucciniaceae |
| fast5_compression | vbz |
| flowcell_id | PAS14798 |
| flowcell_type | FLO-PRO114M |
| folder_name | 20240802_PP_BRF_PAS14798 (sample ID 395629 - 395696, not consecutive) |
| genus | Puccinia |
| host_common_name | Bread wheat |
| host_family | Poaceae |
| host_organ | Leaf |
| host_scientific_name | Triticum aestivum |
| host_status | Cereal crop |
| host_symptom | Fungal spores on leaves |
| insert_size_range | 1600.0 |
| isolate | Pst198E |
| library_comments | poly-A enrichment of total RNA from infected wheat plants or fungal spores, followed by 2nd strand cDNA synthesis and native ONT barcoding |
| library_construction_protocol | SQK-NBD114.96 |
| library_id | 398320 |
| library_index_id | barcode57 |
| library_index_id_dual | NA |
| library_index_seq | GCTAGGTCAATCTCCTTCGGAAGT |
| library_index_seq_dual | NA |
| library_layout | NA |
| library_location | BRF labs |
| library_ng_ul | 29.2 |
| library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
| library_oligo_sequence_dual | NA |
| library_pcr_cycles | NA |
| library_pcr_reps | NA |
| library_prep_date | 2024-06-03 |
| library_prepared_by | Mareike Moeller |
| library_selection | samples were barcoded and pooled based on different time points and replicates |
| library_source | cDNA of infected plant material and spores |
| library_strategy | cDNA ligated with Nanopore native adapters |
| library_type | Direct cDNA |
| material_extraction_type | RNA |
| metadata_revision_date | 2025-06-20 |
| metadata_revision_filename | 2025-04-08_Combined_Plant_Pathogen_sample_metadata_forQCIF_removelatlong.xlsx |
| model_base_caller | Super-accurate basecalling, 400 bps |
| movie_length | NA |
| n_libraries_pooled | 32.0 |
| order | Pucciniales |
| phylum | Basidiomycota |
| project_lead | Benjamin Schwessinger / Mareike Moeller | Australian National University |
| sample_collection_type | University, greenhouse experiment |
| sample_custodian | Benjamin Schwessinger | ANU |
| sample_id | 395665 |
| sample_type | wheat leaf infected with stripe rust |
| scientific_name | Puccinia striiformis f. sp. tritici |
| sequencing_facility | Biomolecular Resource Facility |
| sequencing_kit_chemistry_version | SQK-NBD114.96 |
| sequencing_model | PromethION24 |
| sequencing_platform | Oxford Nanopore |
| species | Puccinia striiformis |
| specimen_custodian | Benjamin Schwessinger | ANU |
| specimen_id | Pst198E |
| specimen_id_description | Puccinia striiformis f. sp. tritici (Pst), pathotype 198E |
| sub_species | Puccinia striiformis f. sp. tritici |
| taxon_id | 168172 |
| taxonomic_group | Fungi |
| ticket | BPAOPS-1645 |
| tissue | infected leaf, 8 dpi, replicate 1 |
| work_order | pool 8 |