Plant Pathogen, Genomics, PromethION, Sample ID 395661
Dataset size is: 0.00 Bit
Data and Resources
-
395661_LibID398384_PP_BRF_PBA005... Metadata Only TAR
-
PP_BRF_PBA00592_ONTPromethION_re... Metadata Only HTML
-
PP_BRF_PBA00592_ONTPromethION_ba... Metadata Only
-
PP_BRF_PBA00592_ONTPromethION_pod5.tar Metadata Only TAR
Optional
-
395661_LibID398384_PP_BRF_PBA005... Metadata Only TAR
-
PP_BRF_PBA00592_ONTPromethION_se... Metadata Only
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:pp-prj044 |
Access Control Date | 2025-08-15 |
Access Control Mode | date |
Sequence Data Type | ont-promethion |
analysis_software | MinKNOW 24.02.19 |
base_url | https://downloads-qcif.bioplatforms.com/bpa/pp_staging/ont-promethion/BPAOPS-1646/20240802_PP_BRF_PBA00592/ |
bioplatforms_dataset_id | 102.100.100/399068 |
bioplatforms_library_id | 102.100.100/398384 |
bioplatforms_project | Plant Pathogen Initiative |
bioplatforms_project_code | PP044_Puccinia_2 |
bioplatforms_sample_id | 102.100.100/395661 |
ccg_jira_ticket | BPAOPS-1646 |
cell_postion | 2E |
class | Pucciniomycetes |
common_name | Stripe rust fungus |
country | Australia |
data_context | Genomics |
data_type | ONT |
date_data_published | 20/08/2024 |
date_of_transfer | 2024-08-15 |
date_of_transfer_to_archive | 2024-08-16 |
description | PromethION - dataset 11 |
dna_treatment | 2nd strand cDNA synthesis from poly-A enriched DNA, direct cDNA synthesis, no PCRs |
download | https://data.bioplatforms.com/dataset/?ext_search_by=&q=ticket%3ABPAOPS-1646 |
facility | BRF |
facility_sample_id | ONT_Lib6_683-8 |
family | Pucciniaceae |
fast5_compression | vbz |
flowcell_id | PBA00592 |
flowcell_type | FLO-PRO114M |
folder_name | 20240802_PP_BRF_PBA00592 (sample ID 395629 - 395696, not consecutive) |
genus | Puccinia |
host_common_name | Bread wheat |
host_family | Poaceae |
host_organ | Leaf |
host_scientific_name | Triticum aestivum |
host_status | Cereal crop |
host_symptom | Fungal spores on leaves |
insert_size_range | 1600.0 |
isolate | Pst198E |
library_comments | poly-A enrichment of total RNA from infected wheat plants or fungal spores, followed by 2nd strand cDNA synthesis and native ONT barcoding |
library_construction_protocol | SQK-NBD114.96 |
library_id | 398384 |
library_index_id | barcode53 |
library_index_id_dual | NA |
library_index_seq | AGATTCAGACCGTCTCATGCAAAG |
library_index_seq_dual | NA |
library_layout | NA |
library_location | BRF labs |
library_ng_ul | 29.2 |
library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
library_oligo_sequence_dual | NA |
library_pcr_cycles | NA |
library_pcr_reps | NA |
library_prep_date | 2024-06-03 |
library_prepared_by | Mareike Moeller |
library_selection | samples were barcoded and pooled based on different time points and replicates |
library_source | cDNA of infected plant material and spores |
library_strategy | cDNA ligated with Nanopore native adapters |
library_type | Direct cDNA |
material_extraction_type | RNA |
metadata_revision_date | 2025-06-20 |
metadata_revision_filename | 2025-04-08_Combined_Plant_Pathogen_sample_metadata_forQCIF_removelatlong.xlsx |
model_base_caller | Super-accurate basecalling, 400 bps |
movie_length | NA |
n_libraries_pooled | 32.0 |
order | Pucciniales |
phylum | Basidiomycota |
project_lead | Benjamin Schwessinger / Mareike Moeller | Australian National University |
sample_collection_type | University, greenhouse experiment |
sample_custodian | Benjamin Schwessinger | ANU |
sample_id | 395661 |
sample_type | wheat leaf infected with stripe rust |
scientific_name | Puccinia striiformis f. sp. tritici |
sequencing_facility | Biomolecular Resource Facility |
sequencing_kit_chemistry_version | SQK-NBD114.96 |
sequencing_model | PromethION24 |
sequencing_platform | Oxford Nanopore |
species | Puccinia striiformis |
specimen_custodian | Benjamin Schwessinger | ANU |
specimen_id | Pst198E |
specimen_id_description | Puccinia striiformis f. sp. tritici (Pst), pathotype 198E |
sub_species | Puccinia striiformis f. sp. tritici |
taxon_id | 168172 |
taxonomic_group | Fungi |
ticket | BPAOPS-1646 |
tissue | infected leaf, 6 dpi, replicate 1 |
work_order | pool 8 |