Plant Pathogen, Genomics, PromethION, Sample ID 395652

Puccinia striiformis f. sp. tritici, Benjamin Schwessinger / Mareike Moeller | Australian National University

Dataset size is: 0.00 b

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:pp-prj044
Access Control Date 2025-06-25
Access Control Mode date
Sequence Data Type ont-promethion
analysis_software MinKNOW 24.02.19
base_url https://downloads-qcif.bioplatforms.com/bpa/pp_staging/ont-promethion/BPAOPS-1600/20240604_PP_BRF_PAQ99770/
bioplatforms_dataset_id 102.100.100/399044
bioplatforms_library_id 102.100.100/397906
bioplatforms_project Plant Pathogen Initiative
bioplatforms_project_code PP044_Puccinia_2
bioplatforms_sample_id 102.100.100/395652
ccg_jira_ticket BPAOPS-1600
cell_postion 3A
class Pucciniomycetes
common_name Stripe rust fungus
country Australia
data_context Genomics
data_type ONT
date_data_published 05/07/2024
date_of_transfer 2024-06-25
date_of_transfer_to_archive 2024-06-27
description PromethION - dataset 3
dna_treatment 2nd strand cDNA synthesis from poly-A enriched DNA, direct cDNA synthesis, no PCRs
download https://data.bioplatforms.com/dataset?ext_search_by=&q=ticket%3ABPAOPS-1600
facility BRF
facility_sample_id ONT_Lib6_683-3
family Pucciniaceae
fast5_compression vbz
flowcell_id PAQ99770
flowcell_type FLO-PRO114M
folder_name 20240604_PP_BRF_PAQ99770 (sample ID 395641 - 395652)
genus Puccinia
host_common_name Bread wheat
host_family Poaceae
host_organ Leaf
host_scientific_name Triticum aestivum
host_status Cereal crop
host_symptom Fungal spores on leaves
insert_size_range 1500.0
isolate Pst134E
library_comments poly-A enrichment of total RNA from infected wheat plants or fungal spores, followed by 2nd strand cDNA synthesis and native ONT barcoding
library_construction_protocol SQK-NBD114.96
library_id 397906
library_index_id barcode24
library_index_id_dual NA
library_index_seq GCATAGTTCTGCATGATGGGTTAG
library_index_seq_dual NA
library_layout NA
library_location BRF labs
library_ng_ul 36.36
library_oligo_sequence 5' - AAGGTTAA - barcode - CAGCACCT - 3'
library_oligo_sequence_dual NA
library_pcr_cycles NA
library_pcr_reps NA
library_prep_date 2024-06-03
library_prepared_by Mareike Moeller
library_selection samples were barcoded and pooled based on different time points and replicates
library_source cDNA of infected plant material and spores
library_strategy cDNA ligated with Nanopore native adapters
library_type Direct cDNA
material_extraction_type RNA
metadata_revision_date 2025-06-20
metadata_revision_filename 2025-04-08_Combined_Plant_Pathogen_sample_metadata_forQCIF_removelatlong.xlsx
model_base_caller Super-accurate basecalling, 400 bps
movie_length NA
n_libraries_pooled 12.0
order Pucciniales
phylum Basidiomycota
project_lead Benjamin Schwessinger / Mareike Moeller | Australian National University
sample_collection_type University, greenhouse experiment
sample_custodian Benjamin Schwessinger | ANU
sample_id 395652
sample_type dormant spores
scientific_name Puccinia striiformis f. sp. tritici
sequencing_facility Biomolecular Resource Facility
sequencing_kit_chemistry_version SQK-NBD114.96
sequencing_model PromethION24
species Puccinia striiformis
specimen_custodian Benjamin Schwessinger | ANU
specimen_id Pst134E
specimen_id_description Puccinia striiformis f. sp. tritici (Pst), pathotype 134E
sub_species Puccinia striiformis f. sp. tritici
taxon_id 168172
taxonomic_group Fungi
ticket BPAOPS-1600
tissue urediniospores, dormant, replicate 4
work_order pool 3