Plant Pathogen, Genomics, PromethION, Sample ID 395635
Dataset size is: 0.00 Bit
This dataset is currently under a short embargo period until July 4, 2028 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
PP_BRF_PAW59324_ONTPromethION_re... Metadata Only HTML
-
395635_LibID397889_PP_BRF_PAW593... Metadata Only TAR
-
395635_LibID397889_PP_BRF_PAW593... Metadata Only TAR
-
PP_BRF_PAW59324_ONTPromethION_se... Metadata Only
-
PP_BRF_PAW59324_ONTPromethION_pod5.tar Metadata Only TAR
Optional
-
PP_BRF_PAW59324_ONTPromethION_ba... Metadata Only
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:pp-prj044 |
Access Control Date | 2028-07-04 |
Access Control Mode | date |
Sequence Data Type | ont-promethion |
analysis_software | MinKNOW 24.02.19 |
base_url | https://downloads-qcif.bioplatforms.com/bpa/pp_staging/ont-promethion/BPAOPS-1607/20240620_PP_BRF_PAW59324/ |
bioplatforms_dataset_id | 102.100.100/399044 |
bioplatforms_library_id | 102.100.100/397889 |
bioplatforms_project | Plant Pathogen Initiative |
bioplatforms_project_code | PP044_Puccinia_2 |
bioplatforms_sample_id | 102.100.100/395635 |
ccg_jira_ticket | BPAOPS-1607 |
cell_postion | 2A |
class | Pucciniomycetes |
common_name | Stripe rust fungus |
country | Australia |
data_context | Genomics |
data_type | ONT |
date_data_published | 09/07/2024 |
date_of_transfer | 2027-07-05 |
date_of_transfer_to_archive | 2024-07-08 |
description | PromethION - dataset 6 |
dna_treatment | 2nd strand cDNA synthesis from poly-A enriched DNA, direct cDNA synthesis, no PCRs |
download | https://data.bioplatforms.com/dataset/?ext_search_by=&q=ticket:BPAOPS-1607 |
facility | BRF |
facility_sample_id | ONT_Lib6_683-2 |
family | Pucciniaceae |
fast5_compression | vbz |
flowcell_id | PAW59324 |
flowcell_type | FLO-PRO114M |
folder_name | 20240620_PP_BRF_PAW59324 (sample ID 395633 - 395640) |
genus | Puccinia |
host_common_name | Bread wheat |
host_family | Poaceae |
host_organ | Leaf |
host_scientific_name | Triticum aestivum |
host_status | Cereal crop |
host_symptom | Fungal spores on leaves |
insert_size_range | 1600.0 |
isolate | Pst134E |
library_comments | poly-A enrichment of total RNA from infected wheat plants or fungal spores, followed by 2nd strand cDNA synthesis and native ONT barcoding |
library_construction_protocol | SQK-NBD114.96 |
library_id | 397889 |
library_index_id | barcode07 |
library_index_seq | AAGGATTCATTCCCACGGTAACAC |
library_index_seq_dual | NA |
library_layout | NA |
library_location | BRF labs |
library_ng_ul | 24.56 |
library_oligo_sequence_dual | NA |
library_pcr_cycles | NA |
library_pcr_reps | NA |
library_prep_date | 2024-06-03 |
library_prepared_by | Mareike Moeller |
library_selection | samples were barcoded and pooled based on different time points and replicates |
library_source | cDNA of infected plant material and spores |
library_strategy | cDNA ligated with Nanopore native adapters |
library_type | Direct cDNA |
material_extraction_type | RNA |
metadata_revision_date | 2025-06-20 |
metadata_revision_filename | 2025-04-08_Combined_Plant_Pathogen_sample_metadata_forQCIF_removelatlong.xlsx |
model_base_caller | Super-accurate basecalling, 400 bps |
movie_length | NA |
n_libraries_pooled | 4.0 |
order | Pucciniales |
phylum | Basidiomycota |
project_lead | Benjamin Schwessinger / Mareike Moeller | Australian National University |
sample_collection_type | University, greenhouse experiment |
sample_custodian | Benjamin Schwessinger | ANU |
sample_id | 395635 |
sample_type | wheat leaf infected with stripe rust |
scientific_name | Puccinia striiformis f. sp. tritici |
sequencing_facility | Biomolecular Resource Facility |
sequencing_kit_chemistry_version | SQK-NBD114.96 |
sequencing_model | PromethION24 |
sequencing_platform | Oxford Nanopore |
species | Puccinia striiformis |
specimen_custodian | Benjamin Schwessinger | ANU |
specimen_id | Pst134E |
specimen_id_description | Puccinia striiformis f. sp. tritici (Pst), pathotype 134E |
sub_species | Puccinia striiformis f. sp. tritici |
taxon_id | 168172 |
taxonomic_group | Fungi |
ticket | BPAOPS-1607 |
tissue | infected leaf, 6 dpi, replicate 3 |
work_order | pool 2 |