Plant Pathogen, Genomics, PromethION, Sample ID 395613
Dataset size is: 0.00 Bit
Data and Resources
-
PP_BRF_PAQ10940_ONTPromethION_re... Metadata Only HTML
-
395613_LibID397867_PP_BRF_PAQ109... Metadata Only TAR
-
PP_BRF_PAQ10940_ONTPromethION_ba... Metadata Only
-
395613_LibID397867_PP_BRF_PAQ109... Metadata Only TAR
-
PP_BRF_PAQ10940_ONTPromethION_se... Metadata Only
-
395613_LibID397867_PP_BRF_PAQ109... Metadata Only TAR
-
395613_LibID397867_PP_BRF_PAQ109... Metadata Only TAR
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:pp-prj044 |
| Access Control Date | 2024-10-31 |
| Access Control Mode | date |
| Sequence Data Type | ont-promethion |
| analysis_software | MinKNOW 23.07.12 |
| associated_media | https://journals.asm.org/doi/10.1128/mbio.01650-17 |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/pp_staging/ont-promethion/BPAOPS-1508/20231023_PP_BRF_PAQ10940/ |
| bioplatforms_dataset_id | 102.100.100/399044 |
| bioplatforms_library_id | 102.100.100/397867 |
| bioplatforms_project | Plant Pathogen Initiative |
| bioplatforms_project_code | PP044_Puccinia_2 |
| bioplatforms_sample_id | 102.100.100/395613 |
| ccg_jira_ticket | BPAOPS-1508 |
| cell_postion | 2H |
| class | Pucciniomycetes |
| collection_date | 1982-01-01 |
| collection_method | Field isolate, singule postule isolation |
| collection_permit | NA |
| collector | Colin Wellings |
| collector_sample_id | Plant Breeding Institute accession number 821559 =415 |
| common_name | Stripe rust fungus |
| country | Australia |
| data_context | Genomics |
| data_type | ONT |
| date_data_published | 06/11/2023 |
| date_of_transfer | 2023-11-01 |
| date_of_transfer_to_archive | 2023-11-02 |
| description | PromethION |
| dna_treatment | unknown -prepared by client |
| download | https://data.bioplatforms.com/dataset?ext_search_by=&q=ticket%3ABPAOPS-1508 |
| facility | BRF |
| facility_sample_id | ONT_Lib1_555_3 |
| family | Pucciniaceae |
| fast5_compression | vbz |
| flowcell_id | PAQ10940 |
| flowcell_type | FLO-PRO114M |
| folder_name | 20231023_PP_BRF_PAQ10940 (sample ID 395613 - 395624) |
| genus | Puccinia |
| host_common_name | Bread wheat |
| host_family | Poaceae |
| host_organ | Leaf |
| host_scientific_name | Triticum aestivum |
| host_status | Cereal crop |
| host_symptom | Fungal spores on leaves |
| insert_size_range | 1400.0 |
| isolate | Pst104E |
| library_comments | Library prepared by client |
| library_construction_protocol | SQK-NBD114.96 |
| library_id | 397867 |
| library_index_id | barcode45 |
| library_index_id_dual | NA |
| library_index_seq | GATCCAACAGAGATGCCTTCAGTG |
| library_index_seq_dual | NA |
| library_layout | NA |
| library_location | BRF labs |
| library_ng_ul | 9.92 |
| library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
| library_oligo_sequence_dual | NA |
| library_pcr_cycles | unknown -prepared by client |
| library_pcr_reps | unknown -prepared by client |
| library_prepared_by | unknown -prepared by client |
| library_selection | unknown -prepared by client |
| library_source | unknown -prepared by client |
| library_strategy | cDNA ligated with Nanopore native adapters |
| library_type | cDNA |
| location_text | Wheat field in NSW |
| material_conc_ng_ul | 1040.0 |
| material_extracted_by | Mareike Moeller | ANU |
| material_extraction_date | 2023-09-14 |
| material_extraction_method | Trizol |
| material_extraction_type | RNA |
| metadata_revision_date | 2025-06-20 |
| metadata_revision_filename | 2025-04-08_Combined_Plant_Pathogen_sample_metadata_forQCIF_removelatlong.xlsx |
| model_base_caller | Super-accurate basecalling, 400 bps |
| movie_length | NA |
| n_libraries_pooled | 12.0 |
| order | Pucciniales |
| phylum | Basidiomycota |
| project_lead | Benjamin Schwessinger / Mareike Moeller | Australian National University |
| sample_collection_type | University, greenhouse experiment |
| sample_custodian | Benjamin Schwessinger | ANU |
| sample_id | 395613 |
| sample_type | Wheat leaf infected with stripe rust |
| scientific_name | Puccinia striiformis f. sp. tritici |
| sequencing_facility | Biomolecular Resource Facility |
| sequencing_kit_chemistry_version | SQK-NBD114.96 |
| sequencing_model | PromethION24 |
| sequencing_platform | Oxford Nanopore |
| species | Puccinia striiformis |
| specimen_custodian | Benjamin Schwessinger | ANU |
| specimen_id | Pst104E |
| specimen_id_description | Puccinia striiformis f. sp. tritici (Pst), pathotype 104E |
| state_or_region | NSW |
| sub_species | Puccinia striiformis f. sp. tritici |
| taxon_id | 168172 |
| taxonomic_group | Fungi |
| ticket | BPAOPS-1508 |
| tissue | Infected leaf, 10 dpi, replicate 1 |
| tissue_preservation | Snap frozen |
| tissue_preservation_temperature | -80C |