Plant Pathogen, Genomics, Illumina Shortread, Sample ID 396015
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:pp-prj046 |
| Access Control Date | 2025-12-04 |
| Access Control Mode | date |
| Sequence Data Type | illumina-shortread |
| analysis_software | DRAGEN Bcl2Fastq |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/pp_staging/illumina-shortread/BPAOPS-1725/ |
| bioplatforms_dataset_id | 102.100.100/399074 |
| bioplatforms_library_id | 102.100.100/398420 |
| bioplatforms_project | Plant Pathogen Initiative |
| bioplatforms_project_code | PP046_Meloidogyne |
| bioplatforms_sample_id | 102.100.100/396015 |
| ccg_jira_ticket | BPAOPS-1725 |
| class | Chromadorea |
| collection_date | 2024-11-26 |
| collector | Yennefer, A. |
| common_name | Northern root knot nematode |
| country | Australia |
| data_context | Genomics |
| data_type | Hi-C |
| date_data_published | 12/12/2024 |
| date_of_transfer | 2024-12-04 |
| date_of_transfer_to_archive | 2024-12-05 |
| decimal_latitude_public | -27.49 |
| decimal_longitude_public | 153.02 |
| description | Illumina Short read |
| dna_treatment | FA crosslinking |
| download | https://data.bioplatforms.com/dataset/?ext_search_by=&q=ticket:BPAOPS-1725 |
| experimental_design | Arima HiC 2.0 |
| facility | BRF |
| facility_project_code | BRF |
| facility_sample_id | 396015_LibID398420_PP_BRF_225MWJLT1_CAGTGACG |
| family | Meloidogynidae |
| flowcell_id | 225MWJLT1 |
| flowcell_type | NovaSeq X 1.5B |
| folder_name | 20241204_PP_BRF_WO20062_225MWJLT1 |
| genus | Meloidogyne |
| host_common_name | Tomato |
| host_family | Solanaceae |
| host_organ | Root |
| host_scientific_name | Solanum lycopersicum |
| host_status | Research culture |
| host_symptom | Galling |
| insert_size_range | ~600bp |
| library_construction_protocol | HiC Arima 2.0 |
| library_id | 398420 |
| library_index_id | NEB_Set3_E12 |
| library_index_sequence | CAGTGACG |
| library_layout | Paired end |
| library_location | BRF Freezer |
| library_ng_ul | 1.3 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGTGACG(AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 12 |
| library_pcr_reps | 1 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction digest |
| library_source | GENOMIC |
| library_strategy | HiC |
| library_type | HiC |
| life_stage | adult |
| location_text | Ecosciences Precinct, Brisbane, Queensland Department of Agriculture and Fisheries |
| metadata_revision_date | 2025-06-20 |
| metadata_revision_filename | 2025-04-08_Combined_Plant_Pathogen_sample_metadata_forQCIF_removelatlong.xlsx |
| n_libraries_pooled | 1.0 |
| order | Rhabditida |
| phylum | Nematoda |
| project_lead | Daniel Huston | CSIRO |
| sample_collection_type | Ethanol |
| sample_custodian | Daniel Huston | CSIRO, ANIC |
| sample_type | Infested roots |
| scientific_name | Meloidogyne hapla |
| scientific_name_authorship | Chitwood, 1949 |
| sequencing_facility | Biomolecular Research Facility - ANU |
| sequencing_model | NovaSeq X |
| sequencing_platform | Illumina |
| source_population | Unknown |
| species | hapla |
| specimen_custodian | CSIRO Australian National Insect Collection (ANIC); Nematology Section (Nema) |
| specimen_id | ANIC NEMA eth 19872 |
| specimen_id_description | Australian National Insect Collection; Nematology ethanol collection |
| state_or_region | Queensland |
| taxon_id | 6305 |
| taxonomic_group | Nematode |
| ticket | BPAOPS-1725 |
| tissue | whole adult female |
| tissue_preservation | Liquid nitrogen onto dry ice |
| tissue_preservation_temperature | -78 C |
| work_order | WO_20062 |