Plant Pathogen, Genomics, Illumina Shortread, Sample ID 395839
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:pp-prj045 |
| Access Control Date | 2025-06-03 |
| Access Control Mode | date |
| Sequence Data Type | illumina-shortread |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/pp_staging/illumina-shortread/BPAOPS-1592/20240531_PP_BRF_399055_LD3WL/ |
| bioplatforms_dataset_id | 102.100.100/399055 |
| bioplatforms_library_id | 102.100.100/398105 |
| bioplatforms_project | Plant Pathogen Initiative |
| bioplatforms_project_code | PP045_P_brassicae |
| bioplatforms_sample_id | 102.100.100/395839 |
| ccg_jira_ticket | BPAOPS-1592 |
| class | Phytomyxea |
| collection_date | 2023-11-28 |
| collector | Subhashini Marri |
| common_name | Clubroot |
| country | Australia |
| data_context | Genomics |
| data_type | Hi-C |
| date_data_published | 11/06/2024 |
| date_of_transfer | 2024-06-03 |
| date_of_transfer_to_archive | 2024-06-04 |
| description | Illumina Short Read (Hi-C) |
| download | https://data.bioplatforms.com/dataset?ext_search_by=&q=ticket%3ABPAOPS-1592 |
| experimental_design | HiC |
| facility | BRF |
| facility_project_code | BRF |
| family | Plasmodiophoridae |
| flowcell_id | LD3WL |
| folder_name | 20240531_PP_BRF_399055_LD3WL |
| genus | Plasmodiophora |
| health_state | disease |
| host_common_name | Spider mustard |
| host_family | Brassicaceae |
| host_organ | Roots |
| host_scientific_name | Brassica juncea var. japonica |
| host_status | Cultivated crop |
| host_symptom | Galling |
| insert_size_range | 100-1000 |
| library_construction_protocol | Phase Genomics Proximo HiC (Fungal ) Kit |
| library_id | 398105 |
| library_index_id | A4 |
| library_index_id_dual | A4 |
| library_index_seq_dual | CGACACTT |
| library_index_sequence | CCACATTG |
| library_layout | Paired end |
| library_location | BRF Freezer |
| library_ng_ul | 0.862 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCACATTGATCTCGTATGCCGTCTTCTGCTTG |
| library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACCGACACTTACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| library_pcr_cycles | 12 |
| library_pcr_reps | 0 |
| library_prepared_by | Lachlan Morrison |
| library_strategy | HiC |
| library_type | Phase Genomics Proximo HiC (Fungal ) Kit |
| life_stage | unknown |
| location_info_restricted | yes |
| location_text | Maffra |
| material_conc_ng_ul | 180 mg wet weight |
| material_extracted_by | Maxim Prokchorchik | University of Sydney |
| material_extraction_date | 2024-05-08 |
| material_extraction_method | gradient centrifugation of plant diseased tissue |
| material_extraction_type | resting spores |
| metadata_revision_date | 2025-06-20 |
| metadata_revision_filename | 2025-04-08_Combined_Plant_Pathogen_sample_metadata_forQCIF_removelatlong.xlsx |
| n_libraries_pooled | 1.0 |
| order | Plasmodiophorida |
| phylum | Endomyxa |
| project_lead | Maxim Prokchorchik | University of Sydney |
| sample_collection_type | University |
| sample_custodian | Maxim Prokchorchik | University of Sydney |
| sample_quality | purified spores |
| sample_type | Field isolate spores |
| scientific_name | Plasmodiophora brassicae |
| scientific_name_authorship | Woronin (1877) |
| sequencing_facility | Biomolecular Research Facility - ANU |
| sequencing_kit_chemistry_version | v2 300 cycles |
| sequencing_model | MiSeq |
| sequencing_platform | Illumina |
| species | brassicae |
| specimen_custodian | Maxim Prokchorchik | University of Sydney |
| specimen_id | VIC2 |
| specimen_id_description | Maxim Prokchorchik | University of Sydney |
| state_or_region | Victoria |
| taxon_id | 37360 |
| taxonomic_group | Protist |
| ticket | BPAOPS-1592 |
| type_status | unknown |
| work_order | 20047 |