Serendipita, reference genome, ont-promethion, Mycelium
Dataset size is: 0.00 b
Data and Resources
-
FUN_BRF_PBE72074_ONTPromethION_s... Metadata Only
-
FUN_BRF_PBE72074_ONTPromethION_r... Metadata Only HTML
-
FUN_BRF_PBE72074_ONTPromethION_b... Metadata Only
-
FUN_BRF_PBE72074_metadata.xlsx Metadata Only XLSX
-
FUN_BRF_PBE72074_ONTPromethION_pod5.tar Metadata Only TAR
Optional
-
467237_FUN_BRF_PBE72074_ONTProme... Metadata Only TAR
-
467237_FUN_BRF_PBE72074_ONTProme... Metadata Only TAR
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:fungi-consortium-members |
| Access Control Date | 2026-07-11 |
| Access Control Mode | date |
| Sequence Data Type | ont-promethion |
| altitude | NA |
| analysis_software | MinKNOW 24.11.11 |
| ancillary_notes | 2046.0 |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/fungi_staging/ont-promethion/BPAOPS-1827/20250707_FUN_BRF_PBE72074/ |
| bioplatforms_dataset_id | 102.100.100/467825 |
| bioplatforms_library_id | 102.100.100/467237 |
| bioplatforms_project | Australian Functional Fungi Initiative |
| bioplatforms_sample_id | 102.100.100/465185 |
| ccg_jira_ticket | BPAOPS-1827 |
| cell_postion | 3C |
| class | Agaricomycetes |
| collection_date | 2017-10-17 |
| collection_method | Isolation of pelotons from plant material |
| collection_permit | SL100294 |
| collector | Fitria Oktalira |
| common_name | Serendipita |
| country | Australia |
| data_context | reference genome |
| data_type | ONT-promethion |
| date_of_transfer | 2025-07-11 |
| date_of_transfer_to_archive | 2025-07-16 |
| depth | NA |
| dna_treatment | Blue pippin 10 Kb size selection |
| env_broad_scale | Woodland biome |
| env_local_scale | NA |
| env_medium | NA |
| experimental_design | ONT long reads |
| facility_project_code | NA |
| facility_sample_id | 964-3 |
| family | Serendipitaceae |
| fast5_compression | pod5 bvz |
| flow_cell_id | PBE72074 |
| flowcell_id | PBE72074 |
| flowcell_type | FLO-PRO114M |
| folder_name | 20250707_FUN_BRF_PBE72074 |
| genus | Serendipita |
| habitat | NA |
| health_state | Healthy |
| host_common_name | Orchid |
| host_family | Orchidaceae |
| host_organ | Collar |
| host_scientific_name | Cyrtostylis reniformis |
| host_status | Wild |
| host_symptom | Asymptomatic |
| identified_by | Fitria Oktalira |
| indigenous_location | Ngunnawal and Ngambri |
| insert_size_range | 30 Kbp |
| isolate | CLM 2046 |
| library_construction_protocol | Native barcoded ligation libraries with NBD114 |
| library_id | 467237 |
| library_index_id | barcode13 |
| library_index_seq | AGAACGACTTCCATACTCGTGTGA |
| library_layout | NA |
| library_location | BRF labs |
| library_ng_ul | 39.6 |
| library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
| library_prep_date | 2025-07-07 |
| library_prepared_by | Carolina Correa-Ospina |
| library_selection | random |
| library_source | genomic |
| library_strategy | WGS |
| library_type | ont-promethion |
| life_stage | mature plant |
| location_info_restricted | Yes |
| location_text | Black Mountain |
| material_conc_ng_ul | 30.4 |
| material_extracted_by | Eric Perreira |
| material_extraction_date | 2023-11-01 |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-08-25 |
| metadata_revision_filename | FUN_MASTER_sample_metadata_FORDP_20250825_NOLATLON.xlsx |
| model_base_caller | Super-accurate basecalling v4.3.0, 400 bps |
| n_libraries_pooled | 5.0 |
| order | Sebacinales |
| phylum | Basidiomycota |
| project_lead | Celeste Linde |
| sample_collection_type | Mycelium |
| sample_custodian | Celeste Linde |
| sample_id | CLM 2046 |
| sample_id_description | Fungal sample |
| sample_quality | Good |
| sample_type | Fungus |
| scientific_name | Serendipita sp. |
| scientific_name_authorship | NA |
| scientific_name_note | Orchid Mycorrhizal Fungi |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | SQK-NBD114.24 |
| sequencing_model | ONT PromethION |
| sequencing_platform | Oxford Nanopore |
| source_population | NA |
| species | OTU R |
| specimen_id | CLM 2046 |
| specimen_id_description | Australian National University |
| state_or_region | Australian Capitol Territory |
| sub_species | NA |
| taxon_id | NA |
| taxonomic_group | Fungi |
| temperature | NA |
| ticket | BPAOPS-1827 |
| tissue | Mycelium |
| tissue_preservation | Frozen |
| tissue_preservation_temperature | -80.0 |
| wild_captive | Wild |
| work_order | 21029.0 |