Serendipita, reference genome, ont-promethion, Mycelium

Serendipitaceae, Serendipita OTU R, CLM 2046, Fungi, Project Lead: Celeste Linde

Dataset size is: 0.00 b

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:fungi-consortium-members
Access Control Date 2026-07-11
Access Control Mode date
Sequence Data Type ont-promethion
altitude NA
analysis_software MinKNOW 24.11.11
ancillary_notes 2046.0
base_url https://downloads-qcif.bioplatforms.com/bpa/fungi_staging/ont-promethion/BPAOPS-1827/20250707_FUN_BRF_PBE72074/
bioplatforms_dataset_id 102.100.100/467825
bioplatforms_library_id 102.100.100/467237
bioplatforms_project Australian Functional Fungi Initiative
bioplatforms_sample_id 102.100.100/465185
ccg_jira_ticket BPAOPS-1827
cell_postion 3C
class Agaricomycetes
collection_date 2017-10-17
collection_method Isolation of pelotons from plant material
collection_permit SL100294
collector Fitria Oktalira
common_name Serendipita
country Australia
data_context reference genome
data_type ONT-promethion
date_of_transfer 2025-07-11
date_of_transfer_to_archive 2025-07-16
depth NA
dna_treatment Blue pippin 10 Kb size selection
env_broad_scale Woodland biome
env_local_scale NA
env_medium NA
experimental_design ONT long reads
facility_project_code NA
facility_sample_id 964-3
family Serendipitaceae
fast5_compression pod5 bvz
flow_cell_id PBE72074
flowcell_id PBE72074
flowcell_type FLO-PRO114M
folder_name 20250707_FUN_BRF_PBE72074
genus Serendipita
habitat NA
health_state Healthy
host_common_name Orchid
host_family Orchidaceae
host_organ Collar
host_scientific_name Cyrtostylis reniformis
host_status Wild
host_symptom Asymptomatic
identified_by Fitria Oktalira
indigenous_location Ngunnawal and Ngambri
insert_size_range 30 Kbp
isolate CLM 2046
library_construction_protocol Native barcoded ligation libraries with NBD114
library_id 467237
library_index_id barcode13
library_index_seq AGAACGACTTCCATACTCGTGTGA
library_layout NA
library_location BRF labs
library_ng_ul 39.6
library_oligo_sequence 5' - AAGGTTAA - barcode - CAGCACCT - 3'
library_prep_date 2025-07-07
library_prepared_by Carolina Correa-Ospina
library_selection random
library_source genomic
library_strategy WGS
library_type ont-promethion
life_stage mature plant
location_info_restricted Yes
location_text Black Mountain
material_conc_ng_ul 30.4
material_extracted_by Eric Perreira
material_extraction_date 2023-11-01
material_extraction_type DNA
metadata_revision_date 2025-08-25
metadata_revision_filename FUN_MASTER_sample_metadata_FORDP_20250825_NOLATLON.xlsx
model_base_caller Super-accurate basecalling v4.3.0, 400 bps
n_libraries_pooled 5.0
order Sebacinales
phylum Basidiomycota
project_lead Celeste Linde
sample_collection_type Mycelium
sample_custodian Celeste Linde
sample_id CLM 2046
sample_id_description Fungal sample
sample_quality Good
sample_type Fungus
scientific_name Serendipita sp.
scientific_name_authorship NA
scientific_name_note Orchid Mycorrhizal Fungi
sequencing_facility BRF
sequencing_kit_chemistry_version SQK-NBD114.24
sequencing_model ONT PromethION
sequencing_platform Oxford Nanopore
source_population NA
species OTU R
specimen_id CLM 2046
specimen_id_description Australian National University
state_or_region Australian Capitol Territory
sub_species NA
taxon_id NA
taxonomic_group Fungi
temperature NA
ticket BPAOPS-1827
tissue Mycelium
tissue_preservation Frozen
tissue_preservation_temperature -80.0
wild_captive Wild
work_order 21029.0