Serendipita, reference genome, ont-promethion, Mycelium
Dataset size is: 0.00 Bit
This dataset is currently under a short embargo period until July 11, 2026 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
FUN_BRF_PBE72074_ONTPromethION_b... Metadata Only
-
FUN_BRF_PBE72074_ONTPromethION_s... Metadata Only
-
467236_FUN_BRF_PBE72074_ONTProme... Metadata Only TAR
-
FUN_BRF_PBE72074_metadata.xlsx Metadata Only XLSX
-
FUN_BRF_PBE72074_ONTPromethION_pod5.tar Metadata Only TAR
Optional
-
467236_FUN_BRF_PBE72074_ONTProme... Metadata Only TAR
-
FUN_BRF_PBE72074_ONTPromethION_r... Metadata Only HTML
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:fungi-consortium-members |
| Access Control Date | 2026-07-11 |
| Access Control Mode | date |
| Sequence Data Type | ont-promethion |
| altitude | NA |
| analysis_software | MinKNOW 24.11.11 |
| ancillary_notes | 1025.0 |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/fungi_staging/ont-promethion/BPAOPS-1827/20250707_FUN_BRF_PBE72074/ |
| bioplatforms_dataset_id | 102.100.100/467825 |
| bioplatforms_library_id | 102.100.100/467236 |
| bioplatforms_project | Australian Functional Fungi Initiative |
| bioplatforms_sample_id | 102.100.100/465184 |
| ccg_jira_ticket | BPAOPS-1827 |
| cell_postion | 3C |
| class | Agaricomycetes |
| collection_date | 2016-10-15 |
| collection_method | Isolation of pelotons from plant material |
| collection_permit | SL100294 |
| collector | Michael Whitehead |
| common_name | Serendipita |
| country | Australia |
| data_context | reference genome |
| data_type | ONT-promethion |
| date_of_transfer | 2025-07-11 |
| date_of_transfer_to_archive | 2025-07-16 |
| depth | NA |
| dna_treatment | Blue pippin 10 Kb size selection |
| env_broad_scale | Woodland biome |
| env_local_scale | NA |
| env_medium | NA |
| experimental_design | ONT long reads |
| facility_project_code | NA |
| facility_sample_id | 964-2 |
| family | Serendipitaceae |
| fast5_compression | pod5 bvz |
| flow_cell_id | PBE72074 |
| flowcell_id | PBE72074 |
| flowcell_type | FLO-PRO114M |
| folder_name | 20250707_FUN_BRF_PBE72074 |
| genus | Serendipita |
| habitat | NA |
| health_state | Healthy |
| host_common_name | Orchid |
| host_family | Orchidaceae |
| host_organ | Collar |
| host_scientific_name | Caladenia nivalis |
| host_status | Wild |
| host_symptom | Asymptomatic |
| identified_by | Fitria Oktalira |
| indigenous_location | Wardandi |
| insert_size_range | 30 Kbp |
| isolate | CLM 1025 |
| library_construction_protocol | Native barcoded ligation libraries with NBD114 |
| library_id | 467236 |
| library_index_id | barcode12 |
| library_index_seq | TCCGATTCTGCTTCTTTCTACCTG |
| library_layout | NA |
| library_location | BRF labs |
| library_ng_ul | 39.6 |
| library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
| library_prep_date | 2025-07-07 |
| library_prepared_by | Carolina Correa-Ospina |
| library_selection | random |
| library_source | genomic |
| library_strategy | WGS |
| library_type | ont-promethion |
| life_stage | mature plant |
| location_info_restricted | Yes |
| location_text | Moses Rock |
| material_conc_ng_ul | 34.2 |
| material_extracted_by | Eric Perreira |
| material_extraction_date | 2023-11-01 |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-08-25 |
| metadata_revision_filename | FUN_MASTER_sample_metadata_FORDP_20250825_NOLATLON.xlsx |
| model_base_caller | Super-accurate basecalling v4.3.0, 400 bps |
| n_libraries_pooled | 5.0 |
| order | Sebacinales |
| phylum | Basidiomycota |
| project_lead | Celeste Linde |
| sample_collection_type | Mycelium |
| sample_custodian | Celeste Linde |
| sample_id | CLM 1025 |
| sample_id_description | Fungal sample |
| sample_quality | Good |
| sample_type | Fungus |
| scientific_name | Serendipita rarihospitum |
| scientific_name_authorship | Oktalira, T.W. May & C.C. Linde |
| scientific_name_note | Orchid Mycorrhizal Fungi |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | SQK-NBD114.24 |
| sequencing_model | ONT PromethION |
| sequencing_platform | Oxford Nanopore |
| source_population | NA |
| species | rarihospitum |
| specimen_id | CLM 1025 |
| specimen_id_description | Australian National University |
| state_or_region | Western Australia |
| sub_species | NA |
| taxon_id | 3376211.0 |
| taxonomic_group | Fungi |
| temperature | NA |
| ticket | BPAOPS-1827 |
| tissue | Mycelium |
| tissue_preservation | Frozen |
| tissue_preservation_temperature | -80.0 |
| wild_captive | Wild |
| work_order | 21029.0 |