Serendipita, reference genome, ont-promethion, Mycelium
Dataset size is: 0.00 Bit
This dataset is currently under a short embargo period until July 11, 2026 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
FUN_BRF_PBE72074_ONTPromethION_b... Metadata Only
-
FUN_BRF_PBE72074_metadata.xlsx Metadata Only XLSX
-
467235_FUN_BRF_PBE72074_ONTProme... Metadata Only TAR
-
467235_FUN_BRF_PBE72074_ONTProme... Metadata Only TAR
-
FUN_BRF_PBE72074_ONTPromethION_pod5.tar Metadata Only TAR
Optional
-
FUN_BRF_PBE72074_ONTPromethION_s... Metadata Only
-
FUN_BRF_PBE72074_ONTPromethION_r... Metadata Only HTML
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:fungi-consortium-members |
| Access Control Date | 2026-07-11 |
| Access Control Mode | date |
| Sequence Data Type | ont-promethion |
| altitude | NA |
| analysis_software | MinKNOW 24.11.11 |
| ancillary_notes | 866.0 |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/fungi_staging/ont-promethion/BPAOPS-1827/20250707_FUN_BRF_PBE72074/ |
| bioplatforms_dataset_id | 102.100.100/467825 |
| bioplatforms_library_id | 102.100.100/467235 |
| bioplatforms_project | Australian Functional Fungi Initiative |
| bioplatforms_sample_id | 102.100.100/465183 |
| ccg_jira_ticket | BPAOPS-1827 |
| cell_postion | 3C |
| class | Agaricomycetes |
| collection_date | 2015-10-18 |
| collection_method | Isolation of pelotons from plant material |
| collection_permit | SL100294 |
| collector | Ryan Phillips |
| common_name | Serendipita |
| country | Australia |
| data_context | reference genome |
| data_type | ONT-promethion |
| date_of_transfer | 2025-07-11 |
| date_of_transfer_to_archive | 2025-07-16 |
| depth | NA |
| dna_treatment | Blue pippin 10 Kb size selection |
| env_broad_scale | Woodland biome |
| env_local_scale | NA |
| env_medium | NA |
| experimental_design | ONT long reads |
| facility_project_code | NA |
| facility_sample_id | 964-1 |
| family | Serendipitaceae |
| fast5_compression | pod5 bvz |
| flow_cell_id | PBE72074 |
| flowcell_id | PBE72074 |
| flowcell_type | FLO-PRO114M |
| folder_name | 20250707_FUN_BRF_PBE72074 |
| genus | Serendipita |
| habitat | NA |
| health_state | Healthy |
| host_common_name | Orchid |
| host_family | Orchidaceae |
| host_organ | Collar |
| host_scientific_name | Caladenia procera |
| host_status | Wild |
| host_symptom | Asymptomatic |
| identified_by | Fitria Oktalira |
| indigenous_location | Wadandi |
| insert_size_range | 30 Kbp |
| isolate | CLM 866 |
| library_construction_protocol | Native barcoded ligation libraries with NBD114 |
| library_id | 467235 |
| library_index_id | barcode11 |
| library_index_seq | TCCATTCCCTCCGATAGATGAAAC |
| library_layout | NA |
| library_location | BRF labs |
| library_ng_ul | 39.6 |
| library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
| library_prep_date | 2025-07-07 |
| library_prepared_by | Carolina Correa-Ospina |
| library_selection | random |
| library_source | genomic |
| library_strategy | WGS |
| library_type | ont-promethion |
| life_stage | mature plant |
| location_info_restricted | Yes |
| location_text | Busselton |
| material_conc_ng_ul | 31.4 |
| material_extracted_by | Eric Perreira |
| material_extraction_date | 2023-11-01 |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-08-25 |
| metadata_revision_filename | FUN_MASTER_sample_metadata_FORDP_20250825_NOLATLON.xlsx |
| model_base_caller | Super-accurate basecalling v4.3.0, 400 bps |
| n_libraries_pooled | 5.0 |
| order | Sebacinales |
| phylum | Basidiomycota |
| project_lead | Celeste Linde |
| sample_collection_type | Mycelium |
| sample_custodian | Celeste Linde |
| sample_id | CLM 866 |
| sample_id_description | Fungal sample |
| sample_quality | Good |
| sample_type | Fungus |
| scientific_name | Serendipita rarihospitum |
| scientific_name_authorship | Oktalira, T.W. May & C.C. Linde |
| scientific_name_note | Orchid Mycorrhizal Fungi |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | SQK-NBD114.24 |
| sequencing_model | ONT PromethION |
| sequencing_platform | Oxford Nanopore |
| source_population | NA |
| species | rarihospitum |
| specimen_id | CLM 866 |
| specimen_id_description | Australian National University |
| state_or_region | Western Australia |
| sub_species | NA |
| taxon_id | 3376211.0 |
| taxonomic_group | Fungi |
| temperature | NA |
| ticket | BPAOPS-1827 |
| tissue | Mycelium |
| tissue_preservation | Frozen |
| tissue_preservation_temperature | -80.0 |
| wild_captive | Wild |
| work_order | 21029.0 |