TBD, Reference Genome, ONT-PromethION, other

TBD, TBD TBD, Itsy-Bitsy_30, fungi, Project Lead: Jonathan Arundel

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:fungi-consortium-members
Access Control Date 2026-06-10
Access Control Mode date
Sequence Data Type ont-promethion
altitude 782.0
analysis_software MinKNOW 24.11.11
associated_media none
base_url https://downloads-qcif.bioplatforms.com/bpa/fungi_staging/ont-promethion/BPAOPS-1794/20250526_FUN_BRF_PBC58132/
bioplatforms_dataset_id 102.100.100/467824
bioplatforms_library_id 102.100.100/467222
bioplatforms_project Australian Functional Fungi Initiative
bioplatforms_sample_id 102.100.100/465170
ccg_jira_ticket BPAOPS-1794
cell_postion 2H
class TBD
collection_date 2023-04-01
collection_method hand capture
collection_permit NA
collector Jonathan Arundel
collector_sample_id NOOJ2 β I
common_name TBD
country Australia
data_context Reference Genome
data_type ONT-promethion
date_of_transfer 2025-06-10
date_of_transfer_to_archive 2025-06-11
decimal_latitude_public -37.8985753324
decimal_longitude_public 146.0265378257
depth 0
dna_treatment Blue pippin 8 Kb size selection
env_broad_scale terrestrial biome [ENVO_00000446]
env_local_scale temperate rainforest biome [ENVO_01001962]
env_medium plant_litter [ENVO_01000628]; humus [ENVO_01000000]; soil [ENVO_00001998]
experimental_design ONT long reads
facility_project_code NA
facility_sample_id 932_20
family TBD
fast5_compression pod5 bvz
flow_cell_id PBC58132
flowcell_id PBC58132
flowcell_type FLO-PRO114M
folder_name 20250526_FUN_BRF_PBC58132
genus TBD
health_state healthy
host_common_name TBD
host_family Nothofagaceae
host_organ other
host_scientific_name Nothofagus cunninghamii
host_status wild
host_symptom NA
identified_by Jonathan Arundel
indigenous_location Wurundjeri
insert_size_range 14 Kbp
isolate yeast
library_construction_protocol Native barcoded ligation libraries with NBD133
library_id 467222
library_index_id barcode20
library_index_seq TTGCGTCCTGTTACGAGAACTCAT
library_layout NA
library_location BRF labs
library_ng_ul 5.29
library_oligo_sequence 5' - AAGGTTAA - barcode - CAGCACCT - 3'
library_prep_date 2025-05-26
library_prepared_by Carolina Correa-Ospina
library_selection random
library_source genomic
library_strategy WGS
library_type ONT-PromethION
life_stage cell line
location_info_restricted no
location_text Noojee
material_conc_ng_ul 189.0
material_extracted_by Ashley Jones
material_extraction_date 2025-04-30
material_extraction_method 2 mL tube prep with 2 ball bearings, 2 min tissueLyzer. An SDS lysis buffer, cleaned with chloroform: isoamyl alcohol, bound to beads and eluted in 10 mM Tris-HCL pH 8. Full details at https://doi.org/10.1371/journal.pone.0253830
material_extraction_type DNA
metadata_revision_date 2025-08-25
metadata_revision_filename FUN_MASTER_sample_metadata_FORDP_20250825_NOLATLON.xlsx
model_base_caller Super-accurate basecalling v4.3.0, 400 bps
n_libraries_pooled 32.0
order TBD
phylum TBD
project_collaborators Itsy-Bitsy, Ashley Jones, Benjamin Schwessinger
project_lead Jonathan Arundel
sample_collection_type living collection
sample_custodian Jonathan Arundel
sample_id Itsy-Bitsy_30
sample_id_description NA
sample_quality excellent
sample_type single cell
scientific_name TBD
scientific_name_authorship TBD
scientific_name_note TBD
sequencing_facility BRF
sequencing_kit_chemistry_version SQK-NBD114.24
sequencing_model ONT PromethION
sequencing_platform Oxford Nanopore
source_population NA
species TBD
specimen_custodian Itsy-Bitsy
specimen_id 30.0
specimen_id_description sequence number of yeast sample for novel wild Australian yeasts for food and beverage production project
state_or_region Victoria
sub_species TBD
taxon_id TBD
taxonomic_group fungi
ticket BPAOPS-1794
tissue other
tissue_preservation Refrigeration
tissue_preservation_temperature 3.0
type_status TBD
wild_captive wild
work_order 21028.0