TBD, Reference Genome, ONT-PromethION, other
Dataset size is: 0.00 Bit
This dataset is currently under a short embargo period until June 10, 2026 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
FUN_BRF_PBC58132_metadata.xlsx Metadata Only XLSX
-
467216_FUN_BRF_PBC58132_ONTProme... Metadata Only TAR
-
467216_FUN_BRF_PBC58132_ONTProme... Metadata Only TAR
-
FUN_BRF_PBC58132_ONTPromethION_b... Metadata Only
-
FUN_BRF_PBC58132_ONTPromethION_s... Metadata Only
-
FUN_BRF_PBC58132_ONTPromethION_r... Metadata Only HTML
-
FUN_BRF_PBC58132_ONTPromethION_pod5.tar Metadata Only TAR
Optional
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:fungi-consortium-members |
| Access Control Date | 2026-06-10 |
| Access Control Mode | date |
| Sequence Data Type | ont-promethion |
| altitude | 240.0 |
| analysis_software | MinKNOW 24.11.11 |
| associated_media | none |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/fungi_staging/ont-promethion/BPAOPS-1794/20250526_FUN_BRF_PBC58132/ |
| bioplatforms_dataset_id | 102.100.100/467824 |
| bioplatforms_library_id | 102.100.100/467216 |
| bioplatforms_project | Australian Functional Fungi Initiative |
| bioplatforms_sample_id | 102.100.100/465164 |
| ccg_jira_ticket | BPAOPS-1794 |
| cell_postion | 2H |
| class | TBD |
| collection_date | 2024-11-02 |
| collection_method | hand capture |
| collection_permit | NA |
| collector | Jonathan Arundel |
| collector_sample_id | NARR1 γ B |
| common_name | TBD |
| country | Australia |
| data_context | Reference Genome |
| data_type | ONT-promethion |
| date_of_transfer | 2025-06-10 |
| date_of_transfer_to_archive | 2025-06-11 |
| decimal_latitude_public | -32.232254599 |
| decimal_longitude_public | 148.2489736077 |
| depth | 0 |
| dna_treatment | Blue pippin 8 Kb size selection |
| env_broad_scale | terrestrial biome [ENVO_00000446] |
| env_local_scale | temperate woodland biome [ENVO_01000221] |
| env_medium | plant_litter [ENVO_01000628]; humus [ENVO_01000000]; soil [ENVO_00001998] |
| experimental_design | ONT long reads |
| facility_project_code | NA |
| facility_sample_id | 932_14 |
| family | TBD |
| fast5_compression | pod5 bvz |
| flow_cell_id | PBC58132 |
| flowcell_id | PBC58132 |
| flowcell_type | FLO-PRO114M |
| folder_name | 20250526_FUN_BRF_PBC58132 |
| genus | TBD |
| health_state | healthy |
| host_common_name | TBD |
| host_family | Casuarinaceae |
| host_organ | other |
| host_scientific_name | Casuarina cristata |
| host_status | wild |
| host_symptom | NA |
| identified_by | Jonathan Arundel |
| indigenous_location | Wiradjuri |
| insert_size_range | 14 Kbp |
| isolate | yeast |
| library_construction_protocol | Native barcoded ligation libraries with NBD127 |
| library_id | 467216 |
| library_index_id | barcode14 |
| library_index_seq | AACGAGTCTCTTGGGACCCATAGA |
| library_layout | NA |
| library_location | BRF labs |
| library_ng_ul | 5.29 |
| library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
| library_prep_date | 2025-05-26 |
| library_prepared_by | Carolina Correa-Ospina |
| library_selection | random |
| library_source | genomic |
| library_strategy | WGS |
| library_type | ONT-PromethION |
| life_stage | cell line |
| location_info_restricted | no |
| location_text | Narromine |
| material_conc_ng_ul | 140.0 |
| material_extracted_by | Ashley Jones |
| material_extraction_date | 2025-04-30 |
| material_extraction_method | 2 mL tube prep with 2 ball bearings, 2 min tissueLyzer. An SDS lysis buffer, cleaned with chloroform: isoamyl alcohol, bound to beads and eluted in 10 mM Tris-HCL pH 8. Full details at https://doi.org/10.1371/journal.pone.0253830 |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-08-25 |
| metadata_revision_filename | FUN_MASTER_sample_metadata_FORDP_20250825_NOLATLON.xlsx |
| model_base_caller | Super-accurate basecalling v4.3.0, 400 bps |
| n_libraries_pooled | 32.0 |
| order | TBD |
| phylum | TBD |
| project_collaborators | Itsy-Bitsy, Ashley Jones, Benjamin Schwessinger |
| project_lead | Jonathan Arundel |
| sample_collection_type | living collection |
| sample_custodian | Jonathan Arundel |
| sample_id | Itsy-Bitsy_24 |
| sample_id_description | NA |
| sample_quality | excellent |
| sample_type | single cell |
| scientific_name | TBD |
| scientific_name_authorship | TBD |
| scientific_name_note | TBD |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | SQK-NBD114.24 |
| sequencing_model | ONT PromethION |
| sequencing_platform | Oxford Nanopore |
| source_population | NA |
| species | TBD |
| specimen_custodian | Itsy-Bitsy |
| specimen_id | 24.0 |
| specimen_id_description | sequence number of yeast sample for novel wild Australian yeasts for food and beverage production project |
| state_or_region | New South Wales |
| sub_species | TBD |
| taxon_id | TBD |
| taxonomic_group | fungi |
| ticket | BPAOPS-1794 |
| tissue | other |
| tissue_preservation | Refrigeration |
| tissue_preservation_temperature | 3.0 |
| type_status | TBD |
| wild_captive | wild |
| work_order | 21028.0 |