Penicillium, Reference Genome, ONT-PromethION, Purified Penicillium spores and mycelia grown on PDA plate

Aspergillaceae, Penicillium NA, SRB_DNA, Fungi, Project Lead: John Rathjen

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:fungi-consortium-members
Access Control Date 2026-06-23
Access Control Mode date
Sequence Data Type ont-promethion
altitude NA
analysis_software MinKNOW 24.11.11
ancillary_notes none
associated_media Images of colonies available
base_url https://downloads-qcif.bioplatforms.com/bpa/fungi_staging/ont-promethion/BPAOPS-1798/20250616_FUN_BRF_PBC52220/
bioplatforms_dataset_id 102.100.100/467822
bioplatforms_library_id 102.100.100/467171
bioplatforms_project Australian Functional Fungi Initiative
bioplatforms_sample_id 102.100.100/465119
ccg_jira_ticket BPAOPS-1798
cell_postion 1E
class Eurotiomycetes
collection_date 2022-10-21
collection_method Environment: collected rust infected leaves, kept at high humidity to promote growth then subcultured fluffy growth until a pure culture was obtained
collector Jack Wess (ANU)
common_name Penicillium
country Australia
data_context Reference Genome
data_type ONT-promethion
date_of_transfer 2025-06-23
date_of_transfer_to_archive 2025-06-24
decimal_latitude_public NA
decimal_longitude_public NA
depth NA
dna_treatment Blue pippin 8 Kb size selection
env_broad_scale Artificial growth conditions habitat
env_local_scale Growth cabinet
env_medium Stem rust infected wheat leaf
experimental_design ONT long reads
facility_project_code NA
facility_sample_id 914-6
family Aspergillaceae
fast5_compression pod5 bvz
flow_cell_id PBC52220
flowcell_id PBC52220
flowcell_type FLO-PRO114M
folder_name 20250616_FUN_BRF_PBC52220
genus Penicillium
habitat Controlled Environment Facility growth chamber
health_state NA
host_common_name Stem rust
host_family Pucciniaceae
host_organ NA
host_scientific_name Puccinia graminis tritici
host_status Cultivated
host_symptom White fluffy growth
identified_by Jack Wess (ANU)
indigenous_location Ngunnawal and Ngambri land
insert_size_range 13 Kbp
isolate Sample discovered growing on stem rust pustules in planta
library_construction_protocol Native barcoded ligation libraries with NBD114
library_id 467171
library_index_id barcode05
library_index_seq AAGGTTACACAAACCCTGGACAAG
library_layout NA
library_location BRF labs
library_ng_ul 13.2
library_oligo_sequence 5' - AAGGTTAA - barcode - CAGCACCT - 3'
library_prep_date 2025-06-18
library_prepared_by Carolina Correa-Ospina
library_selection random
library_source genomic
library_strategy WGS
library_type ONT-PromethION
life_stage Other (mature fungal colony)
location_info_restricted NA
location_text The Australian National University, 46 Sullivans Creek Rd, Acton ACT 2601
material_conc_ng_ul 24.7
material_extracted_by Jack Wess
material_extraction_date 2025-01-15
material_extraction_method CTAB/SDS_HMW
material_extraction_type DNA
metadata_revision_date 2025-08-25
metadata_revision_filename FUN_MASTER_sample_metadata_FORDP_20250825_NOLATLON.xlsx
model_base_caller Super-accurate basecalling v4.3.0, 400 bps
n_libraries_pooled 9.0
order Eurotiales
phylum Ascomycota
project_collaborators Jack Wess
project_lead John Rathjen
sample_collection_type cultivated plants
sample_custodian Jack Wess, Australian National University
sample_id SRB_DNA
sample_quality Highly pure
sample_type whole organism
scientific_name Penicillium sp.
scientific_name_authorship Jack Wess
scientific_name_note All identifications are to genus level and identified via sequencing the ITS barcode region of the fungus
sequencing_facility BRF
sequencing_kit_chemistry_version SQK-NBD114.24
sequencing_model ONT PromethION
sequencing_platform Oxford Nanopore
source_population NA
species NA
specimen_custodian Jack Wess, Australian National University
specimen_id SRB_DNA
specimen_id_description Short-hand identifier used by researcher
state_or_region Australian Capital Territory
sub_species NA
taxon_id NA
taxonomic_group Fungi
temperature 22.0
ticket BPAOPS-1798
tissue Purified Penicillium spores and mycelia grown on PDA plate
tissue_preservation 25% glycerol stock of pure Penicillium spores
tissue_preservation_temperature -80.0
type_status NA
wild_captive NA
work_order 21026.0