Black Fungus, black bread mould, reference genome, ONT-PromethION, Nasal soft tissue

Mucoraceae, Rhizopus arrhizus, CLIN_002_Mycelia_DNA, Fungi, Project Lead: Caterina Selva

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:fungi-consortium-members
Access Control Date 2026-02-26
Access Control Mode date
Sequence Data Type ont-promethion
altitude NA
analysis_software MinKNOW 24.11.11
ancillary_notes NA
associated_media None
base_url https://downloads-qcif.bioplatforms.com/bpa/fungi_staging/ont-promethion/BPAOPS-1762/20250218_FUN_BRF_PBA04981/
bioplatforms_dataset_id 102.100.100/467801
bioplatforms_library_id 102.100.100/466448
bioplatforms_project Australian Functional Fungi Initiative
bioplatforms_sample_id 102.100.100/464448
ccg_jira_ticket BPAOPS-1762
cell_postion 3E
class Mucoromycetes
collection_date 2021-06-01
collection_method Culturing on Potato Dextrose Broth
collection_permit Institutional Biosafety Committee (IBC)
collector Caterina Selva
collector_sample_id CLIN_002
common_name Black Fungus, black bread mould
country Australia
data_context reference genome
data_type ONT-promethion
date_of_transfer 2025-02-26
date_of_transfer_to_archive 2025-02-28
decimal_latitude_public NA
decimal_longitude_public NA
depth NA
dna_treatment Blue pippin 15 Kb size selection
env_broad_scale NA
env_local_scale NA
env_medium NA
experimental_design ONT long reads
facility_project_code NA
facility_sample_id 864-3
family Mucoraceae
fast5_compression pod5 bvz
flow_cell_id PBA04981
flowcell_id PBA04981
flowcell_type FLO-PRO114M
folder_name /20250218_FUN_BRF_PBA04981
genus Rhizopus
habitat Infected human
health_state Healthy
host_common_name Human
host_family Hominidae
host_organ Respiratory system
host_scientific_name Homo sapiens
host_status Infected human
host_symptom NA
identified_by Caterina Selva, Flinders University
indigenous_location Kaurna
insert_size_range 30 Kbp
isolate Clinical isolate
library_construction_protocol Native barcoded ligation libraries with NBD114
library_id 466448
library_index_id barcode18
library_index_seq CCAAACCCAACAACCTAGATAGGC
library_layout NA
library_location BRF labs
library_ng_ul 8.06
library_oligo_sequence 5' - AAGGTTAA - barcode - CAGCACCT - 3'
library_prep_date 2025-02-19
library_prepared_by Carolina Correa-Ospina
library_selection random
library_source genomic
library_strategy WGS
library_type ONT-PromethION
life_stage NA
location_info_restricted no
location_text Obtained from SA Pathology
material_conc_ng_ul 100.0
material_extracted_by Caterina Selva
material_extraction_date 2024-07-11
material_extraction_method Phenol chloroform
material_extraction_type gDNA
metadata_revision_date 2025-08-25
metadata_revision_filename FUN_MASTER_sample_metadata_FORDP_20250825_NOLATLON.xlsx
model_base_caller Super-accurate basecalling v4.3.0, 400 bps
movie_length 76h
n_libraries_pooled 3.0
order Mucorales
phylum Mucoromycota
project_lead Caterina Selva
sample_collection_type living organism
sample_custodian Caterina Selva
sample_id CLIN_002_Mycelia_DNA
sample_id_description Personal, created by Caterina Selva
sample_quality Absorbance ratios A260/280 and A260/230 within AGRF reccommendations
sample_type tissue sample
scientific_name Rhizopus arrhizus
scientific_name_authorship Fischer, 1892
scientific_name_note Many taxonomic synonyms. For example, R. oryzae and R. delemar
sequencing_facility BRF
sequencing_kit_chemistry_version SQK-NBD114.24
sequencing_model ONT PromethION
sequencing_platform Oxford Nanopore
source_population NA
species arrhizus
specimen_custodian Caterina Selva, Flinders University
specimen_id CLIN_002
specimen_id_description Personal, created by Caterina Selva
state_or_region South Australia
sub_species NA
taxon_id 64495.0
taxonomic_group Fungi
temperature NA
ticket BPAOPS-1762
tissue Nasal soft tissue
tissue_preservation Nucleic acid in MQ water, stored at -20C
tissue_preservation_temperature -20.0
type_status NA
wild_captive None, isolated from infected human
work_order 21003.0