Black Fungus, black bread mould, reference genome, ONT-PromethION, Grain
Dataset size is: 0.00 Bit
Data and Resources
-
466446_FUN_BRF_PBA04981_ONTProme... Metadata Only TAR
-
FUN_BRF_PBA04981_ONTPromethION_s... Metadata Only
-
FUN_BRF_PBA04981_ONTPromethION_r... Metadata Only HTML
-
466446_FUN_BRF_PBA04981_ONTProme... Metadata Only TAR
-
FUN_BRF_PBA04981_metadata.xlsx Metadata Only XLSX
-
FUN_BRF_PBA04981_ONTPromethION_b... Metadata Only
-
FUN_BRF_PBA04981_ONTPromethION_pod5.tar Metadata Only TAR
Optional
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:fungi-consortium-members |
| Access Control Date | 2026-02-26 |
| Access Control Mode | date |
| Sequence Data Type | ont-promethion |
| altitude | NA |
| analysis_software | MinKNOW 24.11.11 |
| ancillary_notes | NA |
| associated_media | None |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/fungi_staging/ont-promethion/BPAOPS-1762/20250218_FUN_BRF_PBA04981/ |
| bioplatforms_dataset_id | 102.100.100/467801 |
| bioplatforms_library_id | 102.100.100/466446 |
| bioplatforms_project | Australian Functional Fungi Initiative |
| bioplatforms_sample_id | 102.100.100/464446 |
| ccg_jira_ticket | BPAOPS-1762 |
| cell_postion | 3E |
| class | Mucoromycetes |
| collection_date | 2021-06-01 |
| collection_method | Culturing on Potato Dextrose Broth |
| collection_permit | Institutional Biosafety Committee (IBC) |
| collector | Caterina Selva |
| collector_sample_id | ENV_001 |
| common_name | Black Fungus, black bread mould |
| country | Australia |
| data_context | reference genome |
| data_type | ONT-promethion |
| date_of_transfer | 2025-02-26 |
| date_of_transfer_to_archive | 2025-02-28 |
| decimal_latitude_public | -34.9689609125 |
| decimal_longitude_public | 138.6387299784 |
| depth | NA |
| dna_treatment | Blue pippin 15 Kb size selection |
| env_broad_scale | NA |
| env_local_scale | NA |
| env_medium | NA |
| experimental_design | ONT long reads |
| facility_project_code | NA |
| facility_sample_id | 864-1 |
| family | Mucoraceae |
| fast5_compression | pod5 bvz |
| flow_cell_id | PBA04981 |
| flowcell_id | PBA04981 |
| flowcell_type | FLO-PRO114M |
| folder_name | /20250218_FUN_BRF_PBA04981 |
| genus | Rhizopus |
| habitat | Maize grains |
| health_state | Healthy |
| host_common_name | Maize |
| host_family | Poaceae |
| host_organ | Grain |
| host_scientific_name | Zea mays |
| host_status | Cultivated |
| host_symptom | NA |
| identified_by | Caterina Selva, Flinders University |
| indigenous_location | Kaurna |
| insert_size_range | 30 Kbp |
| isolate | Environmental isolate |
| library_construction_protocol | Native barcoded ligation libraries with NBD114 |
| library_id | 466446 |
| library_index_id | barcode16 |
| library_index_seq | CGTCAACTGACAGTGGTTCGTACT |
| library_layout | NA |
| library_location | BRF labs |
| library_ng_ul | 8.06 |
| library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
| library_prep_date | 2025-02-19 |
| library_prepared_by | Carolina Correa-Ospina |
| library_selection | random |
| library_source | genomic |
| library_strategy | WGS |
| library_type | ONT-PromethION |
| life_stage | NA |
| location_info_restricted | no |
| location_text | Found growing on maize grains at Waite Campus, Urrbrae |
| material_conc_ng_ul | 100.0 |
| material_extracted_by | Caterina Selva |
| material_extraction_date | 2024-07-11 |
| material_extraction_method | Phenol chloroform |
| material_extraction_type | gDNA |
| metadata_revision_date | 2025-08-25 |
| metadata_revision_filename | FUN_MASTER_sample_metadata_FORDP_20250825_NOLATLON.xlsx |
| model_base_caller | Super-accurate basecalling v4.3.0, 400 bps |
| movie_length | 76h |
| n_libraries_pooled | 3.0 |
| order | Mucorales |
| phylum | Mucoromycota |
| project_lead | Caterina Selva |
| sample_collection_type | living organism |
| sample_custodian | Caterina Selva |
| sample_id | ENV_001_Mycelia_DNA |
| sample_id_description | Personal, created by Caterina Selva |
| sample_quality | Absorbance ratios A260/280 and A260/230 within AGRF reccommendations |
| sample_type | tissue sample |
| scientific_name | Rhizopus arrhizus |
| scientific_name_authorship | Fischer, 1892 |
| scientific_name_note | Many taxonomic synonyms. For example, R. oryzae and R. delemar |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | SQK-NBD114.24 |
| sequencing_model | ONT PromethION |
| sequencing_platform | Oxford Nanopore |
| source_population | NA |
| species | arrhizus |
| specimen_custodian | Caterina Selva, Flinders University |
| specimen_id | ENV_001 |
| specimen_id_description | Personal, created by Caterina Selva |
| state_or_region | South Australia |
| sub_species | NA |
| taxon_id | 64495.0 |
| taxonomic_group | Fungi |
| temperature | NA |
| ticket | BPAOPS-1762 |
| tissue | Grain |
| tissue_preservation | Nucleic acid in MQ water, stored at -20C |
| tissue_preservation_temperature | -20.0 |
| type_status | NA |
| wild_captive | None, found growing on maize grains |
| work_order | 21003.0 |