unclassified Cryoendolithus, reference genome, ont-promethion, NA
Dataset size is: 0.00 Bit
Data and Resources
-
FUN_BRF_PAW74909_metadata.xlsx Metadata Only XLSX
-
FUN_BRF_PAW74909_ONTPromethION_r... Metadata Only HTML
-
FUN_BRF_PAW74909_ONTPromethION_b... Metadata Only
-
FUN_BRF_PAW74909_ONTPromethION_s... Metadata Only
-
465909_FUN_BRF_PAW74909_ONTProme... Metadata Only TAR
-
FUN_BRF_PAW74909_ONTPromethION_pod5.tar Metadata Only TAR
Optional
-
465909_FUN_BRF_PAW74909_ONTProme... Metadata Only TAR
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:fungi-consortium-members |
| Access Control Date | 2025-10-22 |
| Access Control Mode | date |
| Sequence Data Type | ont-promethion |
| altitude | 25.25 |
| analysis_software | MinKNOW 24.06.14 |
| ancillary_notes | Funding: AAS-4406 |
| associated_media | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/fungi_staging/ont-promethion/BPAOPS-1708/20241017_FUN_BRF_PAW74909/ |
| bioplatforms_dataset_id | 102.100.100/467798 |
| bioplatforms_library_id | 102.100.100/465909 |
| bioplatforms_project | Australian Functional Fungi Initiative |
| bioplatforms_sample_id | 102.100.100/463909 |
| ccg_jira_ticket | BPAOPs-1708 |
| cell_postion | 2E |
| class | Dothideomycetes |
| collection_date | 2019-02-16 |
| collection_method | Dry-sieving |
| collection_permit | ATEP 18-19-4406 |
| collector | Belinda Ferrari, Catherine King, Eden Zhang, Daniel Wilkins, Mark Raymond |
| collector_sample_id | AAD 174394 |
| common_name | unclassified Cryoendolithus |
| country | Antarctica |
| data_context | reference genome |
| data_type | ONT-promethion |
| date_of_transfer | 2024-10-22 |
| date_of_transfer_to_archive | 2024-10-24 |
| decimal_latitude_public | -66.36774 |
| decimal_longitude_public | 110.58534 |
| depth | 0.03-0.1 |
| dna_treatment | Blue pippin 10Kb size selection |
| env_broad_scale | polar biome [ENVO_01000339] |
| env_local_scale | polar desert biome [ENVO_01000186], cold desert [ENVO_01000382] |
| env_medium | soil [ENVO_00001998] |
| experimental_design | ONT long reads |
| facility_project_code | NA |
| facility_sample_id | ONT_gDNA132_790_2 |
| family | Cladosporiaceae |
| fast5_compression | pod5 bvz |
| flow_cell_id | PAW74909 |
| flowcell_id | PAW74909 |
| flowcell_type | FLO-PRO114M |
| folder_name | 20241017_FUN_BRF_PAW74909 |
| genus | Cryoendolithus |
| habitat | polar desert biome |
| health_state | NA |
| host_common_name | NA |
| host_family | NA |
| host_organ | NA |
| host_scientific_name | NA |
| host_status | NA |
| host_symptom | NA |
| identified_by | Priyanka R. Majumdar | Nicole Benaud | Xabier Vázquez-Campos | Belinda Ferrari | Brett Summerell |
| indigenous_location | NA |
| insert_size_range | 24.1 Kbp |
| isolate | KMR193 |
| library_construction_protocol | Native barcoded ligation libraries with NBD114 |
| library_id | 465909 |
| library_index_id | barcode23 |
| library_index_seq | CTTACTACCCAGTGAACCTCCTCG |
| library_layout | ONT-PromethION |
| library_location | BRF labs |
| library_ng_ul | 4.35 |
| library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
| library_prep_date | 2024-10-17 |
| library_prepared_by | Ziyan Zhang |
| library_selection | random |
| library_source | genomic |
| library_strategy | WGS |
| library_type | ont-promethion |
| life_stage | NA |
| location_info_restricted | no |
| location_text | Robinson Ridge |
| material_conc_ng_ul | unknown |
| material_extracted_by | Priyanka R. Majumdar |
| material_extraction_method | CTAB-based |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-08-25 |
| metadata_revision_filename | FUN_MASTER_sample_metadata_FORDP_20250825_NOLATLON.xlsx |
| model_base_caller | Super-accurate basecalling v4.3.0, 400 bps |
| movie_length | 72h |
| n_libraries_pooled | 3.0 |
| order | Cladosporiales |
| phylum | Ascomycota |
| project_lead | Belinda Ferrari |
| sample_collection_type | Living collection |
| sample_custodian | Belinda Ferrari (UNSW) |
| sample_id | KMR193_DNA_LR |
| sample_id_description | specimen_id+extracted_material(+condition+replicate) |
| sample_quality | Excellent |
| sample_type | Whole organism |
| scientific_name | unclassified Cryoendolithus |
| scientific_name_authorship | M. Piątek, M. Stryjak-Bogacka & P. Czachura |
| scientific_name_note | new sp. - undescribed. No placeholder for undescribed Cryoendolithus available |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | SQK-NBD114.24 |
| sequencing_model | ONT PromethION |
| sequencing_platform | Oxford Nanopore |
| source_population | NA |
| specimen_custodian | Belinda Ferrari (UNSW) |
| specimen_id | KMR193 |
| specimen_id_description | Ferrari lab fungal Internal identifier |
| state_or_region | Eastern ANorthern Territoryarctica |
| taxon_id | 3112694.0 |
| taxonomic_group | Fungi |
| temperature | unknown |
| ticket | BPAOPS-1708 |
| tissue | NA |
| tissue_preservation | NA |
| tissue_preservation_temperature | NA |
| type_status | NA |
| wild_captive | Other (culture) |
| work_order | 21017.0 |