Bynoe's Gecko, Phylogenomics, Illumina-shortread, liver

Gekkonidae, Heteronotia binoei, SMZ2632, Squamata, Project Lead: Stephen Zozaya

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

This dataset has no data

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members
Access Control Date 2024-11-09
Access Control Mode date
Sequence Data Type Illumina-shortread
access_rights No restrictions
ala_specimen_url unknown
analysis_software Bcl2Fastq
ancillary_notes NA
associated_media NA
barcode_id NA
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/illumina-fastq/BPAOPS-1712/AusARG_BRF_351865_351866_351867_223NKKLT1/
bioplatforms_dataset_id 102.100.100/351865
bioplatforms_library_id 102.100.100/456900
bioplatforms_sample_id 102.100.100/458380
cell_postion N/A
certainty high
class Reptilia
collection_date 2022-08-09
collection_method unknown
collector Stephen Zozaya | Scott Macor | Naomi Laven | Anders Zimny
collector_sample_id SMZ2632
common_name Bynoe's Gecko
country Australia
data_context Phylogenomics
data_custodian Stephen Zozaya
data_type Illumina-shortread
dataset_id 102.100.100/351865
date_of_transfer 2024-10-30
date_of_transfer_to_archive 2024-10-31
decimal_latitude_public -16.9203
decimal_longitude_public 137.608
description Short reads
dna_treatment 5 Bioruptor cycles
experimental_design Capture probes
facility BRF
facility_sample_id N/A
family Gekkonidae
file_type FASTQ
flowcell_id 223NKKLT1
flowcell_type 1.5B
folder_name AusARG_BRF_351865_351866_351867_223NKKLT1
genotypic_sex not determined
genus Heteronotia
habitat unknown
identified_by unknown
insert_size_range 150bp PE
institution_name Australian National University
latitude -16.9203
library_comments NA
library_construction_protocol NEXTFLEX_2.0_RapidDNASeq
library_id 102.100.100/456900
library_index_id P7_UDI_1331
library_index_id_dual P5_UDI_1331
library_index_seq TTTCCCAATT
library_index_seq_dual AAACGTACGA
library_layout paired end
library_location EBL Freezers
library_ng_ul 3.692173468
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTTCCCAATTATCTCGTATGCCGTCTTCTGCTTG
library_oligo_sequence_dual AATGATACGGCGACCACCGAGATCTACACAAACGTACGAACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_pcr_cycles 6
library_pcr_reps 2
library_prep_date 2024-08-22
library_prepared_by Liz Broady
library_selection Hybrid Selection
library_source GENOMIC
library_strategy Targeted-Capture
library_type exon capture
lifestage adult organism
location_text Wollogorang Station
longitude 137.608
material_conc_ng_ul 91.1
material_extracted_by Liz Broady
material_extraction_date 2024-06-19
material_extraction_method Salt precipitation
material_extraction_type DNA
metadata_revision_date 2024-11-15
metadata_revision_filename AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx
method_of_determination visual
movie_length N/A
n_libraries_pooled 288
order Squamata
phenotypic_sex female
phylum Chordata
prior_genetics unknown
sample_custodian Stephen Zozaya
sample_id 102.100.100/458380
sample_quality unknown
scientific_name Heteronotia binoei
sequencing_facility Biomolecular Research Facility - ANU
sequencing_kit_chemistry_version 300 cycles
sequencing_model NovaSeq X 1.5B
sequencing_platform Illumina
source_population NA
species binoei
specimen_id SMZ2632
specimen_id_description Australian National University
state_or_region Northern Territory
subspecies NA
taxon_id 13085
taxonomic_group Squamata
ticket BPAOPS-1712
tissue_collection Stephen Zozaya Tissue Collection
tissue_number SMZ2632
tissue_preservation ethanol
tissue_type liver
type_status no
voucher_or_tissue_number SMZ2632
wild_captive wild
work_order 13080