Litchfield spotted gecko, Reference Genome, Illumina-shortread, tail
Dataset size is: 0.00 b
Data and Resources
This dataset has no data
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members |
| Access Control Date | 2023-04-30 |
| Access Control Mode | date |
| Sequence Data Type | Illumina-shortread |
| ala_specimen_url | NA |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/illumina-fastq/BPAOPS-1383/ |
| bioplatforms_dataset_id | 102.100.100/351878 |
| bioplatforms_library_id | 102.100.100/455803 |
| bioplatforms_sample_id | 102.100.100/411656 |
| certainty | high |
| class | Reptilia |
| collector | Keith Christian |
| collector_sample_id | P374 |
| common_name | Litchfield spotted gecko |
| country | Australia |
| data_context | Reference Genome |
| data_custodian | Emily Roycroft |
| data_type | Illumina-shortread |
| dataset_id | 102.100.100/351878 |
| date_of_transfer | 2023-04-20 |
| date_of_transfer_to_archive | 2023-04-27 |
| decimal_latitude_public | -13.124 |
| decimal_longitude_public | 130.804 |
| description | Short reads |
| experimental_design | Illumina DNA Prep, Tagmentation |
| facility | BRF |
| facility_project_code | NA |
| family | Gekkonidae |
| file_type | FASTQ |
| flowcell_id | HKWJJDMXY |
| flowcell_type | Novaseq S2 |
| folder_name | 20230417_AusARG_BRF_351853_351873_351874_351875_351876_351878_HKWJJDMXY |
| genus | Gehyra |
| identified_by | Craig Moritz |
| insert_size_range | ~350 bp |
| institution_name | Australian National University |
| latitude | -13.124 |
| library_construction_protocol | Illumina DNA Prep, Tagmentation |
| library_id | 102.100.100/455803 |
| library_index_id | E4 |
| library_index_id_dual | E4 |
| library_index_seq | CGCTACAT |
| library_index_seq_dual | AGGTCGGA |
| library_layout | paired-end |
| library_location | JCSMR BRF |
| library_ng_ul | 0.598 |
| library_oligo_sequence | CAAGCAGAAGACGGCATACGAGATCGCTACATGTCTCGTGGGCTCGG |
| library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACAGGTCGGATCGTCGGCAGCGTC |
| library_pcr_cycles | 5 |
| library_pcr_reps | 1 |
| library_prep_date | 2023-04-14 |
| library_prepared_by | Lachlan Morrison |
| library_selection | RANDOM |
| library_source | GENOMIC |
| library_strategy | Tagmentation |
| library_type | short read polishing |
| lifestage | adult |
| location_text | Litchfield National Park |
| longitude | 130.804 |
| material_conc_ng_ul | 177.0 |
| material_extracted_by | Emily Roycroft |
| material_extraction_date | 2022-10-12 |
| material_extraction_method | Circulomics NanoBind HMW kit |
| material_extraction_type | DNA |
| metadata_revision_date | 2024-11-15 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx |
| method_of_determination | external and internal mophology |
| n_libraries_pooled | 1 |
| order | Squamata |
| phenotypic_sex | female |
| phylum | Chordata |
| prior_genetics | NA |
| project_aim | Reference genome |
| sample_custodian | Craig Moritz |
| sample_id | 102.100.100/411656 |
| sample_quality | high |
| scientific_name | Gehyra paranana |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | Novaseq v1.5 |
| sequencing_model | Illumina NovaSeq 6000 |
| sequencing_platform | ILLUMINA |
| species | paranana |
| specimen_id | P374 |
| specimen_id_description | ANU tissue collection |
| state_or_region | Northern Territory |
| subspecies | NA |
| taxon_id | 95113 |
| taxonomic_group | lizard |
| ticket | BPAOPS-1383 |
| tissue_collection | Moritz Lab ANU |
| tissue_number | P374 |
| tissue_preservation | frozen -80 |
| tissue_type | tail |
| type_status | no |
| voucher_or_tissue_number | P374 |
| wild_captive | wild |
| work_order | 13053 |