Robust Rock Dtella, Phylogenomics, Illumina-shortread, tail

Gekkonidae, Gehyra robusta, SMZ2427, Squamata, Project Lead: Stephen Zozaya

Dataset size is: 0.00 b

Log in or Register to access resource
 
 

 

Data and Resources

This dataset has no data

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members
Access Control Date 2024-11-09
Access Control Mode date
Sequence Data Type Illumina-shortread
access_rights No restrictions
ala_specimen_url unknown
analysis_software Bcl2Fastq
ancillary_notes NA
associated_media NA
barcode_id NA
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/illumina-fastq/BPAOPS-1712/AusARG_BRF_351865_351866_351867_223NKKLT1/
bioplatforms_dataset_id 102.100.100/351865
bioplatforms_library_id 102.100.100/455779
bioplatforms_sample_id 102.100.100/454298
cell_postion N/A
certainty high
class Reptilia
collection_date 2021-11-30
collection_method unknown
collector Stephen Zozaya | Scott Macor | Naomi Laven
collector_sample_id SMZ2427
common_name Robust Rock Dtella
country Australia
data_context Phylogenomics
data_custodian Stephen Zozaya
data_type Illumina-shortread
dataset_id 102.100.100/351865
date_of_transfer 2024-10-30
date_of_transfer_to_archive 2024-10-31
decimal_latitude_public -20.8982
decimal_longitude_public 139.4401
description Short reads
dna_treatment 5 Bioruptor cycles
experimental_design Capture probes
facility BRF
facility_sample_id N/A
family Gekkonidae
file_type FASTQ
flowcell_id 223NKKLT1
flowcell_type 1.5B
folder_name AusARG_BRF_351865_351866_351867_223NKKLT1
genotypic_sex not determined
genus Gehyra
habitat unknown
identified_by unknown
insert_size_range 150bp PE
institution_name Australian National University
latitude -20.8982
library_comments NA
library_construction_protocol NEXTFLEX_2.0_RapidDNASeq
library_id 102.100.100/455779
library_index_id P7_UDI_1266
library_index_id_dual P5_UDI_1266
library_index_seq CTCCGTTTGT
library_index_seq_dual CTGAAGCCAA
library_layout paired end
library_location EBL Freezers
library_ng_ul 2.898249086
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTCCGTTTGTATCTCGTATGCCGTCTTCTGCTTG
library_oligo_sequence_dual AATGATACGGCGACCACCGAGATCTACACCTGAAGCCAAACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_pcr_cycles 6
library_pcr_reps 2
library_prep_date 2024-08-22
library_prepared_by Liz Broady
library_selection Hybrid Selection
library_source GENOMIC
library_strategy Targeted-Capture
library_type exon capture
lifestage adult organism
location_text Diamantina Development Road, South of Mt Isa
longitude 139.4401
material_conc_ng_ul 37.784
material_extracted_by Rhiannon Schembri
material_extraction_date 2023-04-16
material_extraction_method Macherey-Nagel Plate Extraction Kit
material_extraction_type DNA
metadata_revision_date 2024-11-15
metadata_revision_filename AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx
method_of_determination visual
movie_length N/A
n_libraries_pooled 288
order Squamata
phenotypic_sex male
phylum Chordata
prior_genetics unknown
sample_custodian Stephen Zozaya
sample_id 102.100.100/454298
sample_quality unknown
scientific_name Gehyra robusta
sequencing_facility Biomolecular Research Facility - ANU
sequencing_kit_chemistry_version 300 cycles
sequencing_model NovaSeq X 1.5B
sequencing_platform Illumina
source_population NA
species robusta
specimen_id SMZ2427
specimen_id_description Australian National University
state_or_region Queensland
subspecies NA
taxon_id 747218
taxonomic_group Squamata
ticket BPAOPS-1712
tissue_collection Stephen Zozaya Tissue Collection
tissue_number SMZ2427
tissue_preservation ethanol
tissue_type tail
type_status no
voucher_or_tissue_number SMZ2427
wild_captive wild
work_order 13080