Diamond-shielded Sunskink, Phylogenomics, Illumina-shortread, unknown
Dataset size is: 0.00 b
Data and Resources
This dataset has no data
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members |
| Access Control Date | 2024-11-09 |
| Access Control Mode | date |
| Sequence Data Type | Illumina-shortread |
| access_rights | No restrictions |
| ala_specimen_url | unknown |
| analysis_software | Bcl2Fastq |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/illumina-fastq/BPAOPS-1712/AusARG_BRF_351865_351866_351867_223NKKLT1/ |
| bioplatforms_dataset_id | 102.100.100/351867 |
| bioplatforms_library_id | 102.100.100/455614 |
| bioplatforms_sample_id | 102.100.100/454133 |
| cell_postion | N/A |
| certainty | NA |
| class | Reptilia |
| collection_method | unknown |
| collector | Conrad Hoskin |
| collector_sample_id | CONX3020 |
| common_name | Diamond-shielded Sunskink |
| country | Australia |
| data_context | Phylogenomics |
| data_custodian | Craig Moritz |
| data_type | Illumina-shortread |
| dataset_id | 102.100.100/351867 |
| date_of_transfer | 2024-10-30 |
| date_of_transfer_to_archive | 2024-10-31 |
| decimal_latitude_public | -21.1482 |
| decimal_longitude_public | 148.4592 |
| description | Short reads |
| dna_treatment | 5 Bioruptor cycles |
| experimental_design | Capture probes |
| facility | BRF |
| facility_sample_id | N/A |
| family | Eugongylini |
| file_type | FASTQ |
| flowcell_id | 223NKKLT1 |
| flowcell_type | 1.5B |
| folder_name | AusARG_BRF_351865_351866_351867_223NKKLT1 |
| genotypic_sex | not determined |
| genus | Lampropholis |
| habitat | unknown |
| identified_by | Conrad Hoskin |
| insert_size_range | 150bp PE |
| institution_name | James Cook University |
| latitude | -21.1482 |
| library_comments | NA |
| library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
| library_id | 102.100.100/455614 |
| library_index_id | P7_UDI_0045 |
| library_index_id_dual | P5_UDI_0045 |
| library_index_seq | TCATCGTGGT |
| library_index_seq_dual | GATGCTGGTC |
| library_layout | paired end |
| library_location | EBL Freezers |
| library_ng_ul | 1.310322291 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCATCGTGGTATCTCGTATGCCGTCTTCTGCTTG |
| library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACGATGCTGGTCACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| library_pcr_cycles | 7 |
| library_pcr_reps | 4 |
| library_prep_date | 2024-08-16 |
| library_prepared_by | Liz Broady |
| library_selection | Hybrid Selection |
| library_source | GENOMIC |
| library_strategy | Targeted-Capture |
| library_type | exon capture |
| lifestage | adult organism |
| location_text | Diggins Road, Eungella |
| longitude | 148.4592 |
| material_conc_ng_ul | 17.3 |
| material_extracted_by | Liz Broady |
| material_extraction_date | 2024-06-13 |
| material_extraction_method | Salt precipitation |
| material_extraction_type | DNA |
| metadata_revision_date | 2024-11-15 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx |
| method_of_determination | NA |
| movie_length | N/A |
| n_libraries_pooled | 288 |
| order | Squamata |
| phenotypic_sex | not determined |
| phylum | Chordata |
| prior_genetics | unknown |
| sample_custodian | Stephen Zozaya |
| sample_id | 102.100.100/454133 |
| sample_quality | unknown |
| scientific_name | Lampropholis adonis |
| sequencing_facility | Biomolecular Research Facility - ANU |
| sequencing_kit_chemistry_version | 300 cycles |
| sequencing_model | NovaSeq X 1.5B |
| sequencing_platform | Illumina |
| source_population | NA |
| species | adonis |
| specimen_id | CONX3020 |
| specimen_id_description | Conrad Hoskin Collection |
| state_or_region | Queensland |
| subspecies | NA |
| taxon_id | 1175183 |
| taxonomic_group | Squamata |
| ticket | BPAOPS-1712 |
| tissue_collection | Conrad Hoskin Tissue Collection |
| tissue_number | CONX3020 |
| tissue_preservation | ethanol | frozen |
| tissue_type | unknown |
| type_status | unknown |
| voucher_or_tissue_number | CONX3020 |
| wild_captive | wild |
| work_order | 13080 |