blue-speckled forest-skink, Phylogenomics, Illumina-shortread, tail tip

Scincidae, Silvascincus cf. murrayi, SVM_00129, Squamata, Project Lead: Janne Torkkola

Dataset size is: 0.00 b

Log in or Register to access resource
 
 

 

Data and Resources

This dataset has no data

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members
Access Control Date 2023-12-30
Access Control Mode date
Sequence Data Type Illumina-shortread
access_rights No restrictions
ala_specimen_url NA
analysis_software Bcl2Fastq
ancillary_notes NA
associated_media NA
barcode_id NA
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/illumina-fastq/BPAOPS-1540/20231219_AusARG_BRF_351863_HWLHCDRX3/
bioplatforms_dataset_id 102.100.100/351863
bioplatforms_library_id 102.100.100/455165
bioplatforms_sample_id 102.100.100/412400
certainty NA
class Reptilia
collection_method Hand
collector Stephen Mahoney
collector_sample_id SVM_00129
common_name blue-speckled forest-skink
country Australia
data_context Phylogenomics
data_custodian Janne Torkkola
data_type Illumina-shortread
dataset_id 102.100.100/351863
date_of_transfer 2023-12-20
date_of_transfer_to_archive 2023-12-20
description Short reads
dna_treatment 5 Bioruptor cycles
experimental_design Capture probes
facility BRF
family Scincidae
file_type FASTQ
flowcell_id HWLHCDRX3
flowcell_type Novaseq SP
folder_name 20231219_AusARG_BRF_351863_HWLHCDRX3
genotypic_sex not determined
genus Silvascincus
habitat NA
identified_by Stephen Mahoney
insert_size_range 150bp PE
institution_name Queensland Museum
library_comments NA
library_construction_protocol NEXTFLEX_2.0_RapidDNASeq
library_id 102.100.100/455165
library_index_id p7_UDI_1342
library_index_id_dual p5_UDI_1342
library_index_seq ATAAATATAG
library_index_seq_dual TATAAACAAC
library_layout paired end
library_location ANU EBL Freezer
library_ng_ul 30.1
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCACATAAATATAGATCTCGTATGCCGTCTTCTGCTTG
library_oligo_sequence_dual AATGATACGGCGACCACCGAGATCTACACTATAAACAACACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_pcr_cycles 10
library_pcr_reps 2
library_prep_date 2023-12-04
library_prepared_by Liz Broady
library_selection Hybrid Selection
library_source GENOMIC
library_strategy Targeted-Capture
library_type SqCL2/Exon Capture
lifestage adult
location_text Richmond Range
material_conc_ng_ul 24.0
material_extracted_by Janne Torkkola
material_extraction_date 2023-01-19
material_extraction_method NucleoSpin Kit
material_extraction_type DNA
metadata_revision_date 2024-11-15
metadata_revision_filename AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx
method_of_determination NA
n_libraries_pooled 227
order Squamata
phenotypic_sex not determined
phylum Chordata
prior_genetics NA
project_aim Phylogenomics
sample_custodian Paul M Oliver
sample_id 102.100.100/412400
sample_quality unknown
scientific_name Silvascincus cf. murrayi
sequencing_facility BRF
sequencing_kit_chemistry_version 300 cycles
sequencing_model NovaSeq 6036
sequencing_platform Illumina
source_population Richmond Range
species cf. murrayi
specimen_id SVM_00129
specimen_id_description Queensland Museum Amphibians and Reptiles
state_or_region New South Wales
subspecies NA
taxon_id 204902
taxonomic_group Squamata
ticket BPAOPS-1540
tissue_collection Queensland Museum Amphibians and Reptiles
tissue_number SVM_00129
tissue_preservation ethanol
tissue_type tail tip
type_status NA
voucher_or_tissue_number SVM_00129
wild_captive wild
work_order 13075