Northern Mulch Skink, Phylogenomics, Illumina-shortread, liver

Scincidae, Glaphyromorphus darwiniensis, MAGNT_R21755, Squamata, Project Lead: Janne Torkkola

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members
Access Control Date 2023-12-30
Access Control Mode date
Sequence Data Type Illumina-shortread
access_rights No restrictions
ala_specimen_url NA
analysis_software Bcl2Fastq
ancillary_notes NA
associated_media NA
barcode_id NA
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/illumina-fastq/BPAOPS-1540/20231219_AusARG_BRF_351863_HWLHCDRX3/
bioplatforms_dataset_id 102.100.100/351863
bioplatforms_library_id 102.100.100/455048
bioplatforms_sample_id 102.100.100/412284
certainty NA
class Reptilia
collection_method NA
collector NA
collector_sample_id NA
common_name Northern Mulch Skink
country Australia
data_context Phylogenomics
data_custodian Janne Torkkola
data_type Illumina-shortread
dataset_id 102.100.100/351863
date_of_transfer 2023-12-20
date_of_transfer_to_archive 2023-12-20
description Short reads
dna_treatment 5 Biorupter cycles
experimental_design Capture probes
facility BRF
family Scincidae
file_type FASTQ
flowcell_id HWLHCDRX3
flowcell_type Novaseq SP
folder_name 20231219_AusARG_BRF_351863_HWLHCDRX3
genotypic_sex not determined
genus Glaphyromorphus
habitat NA
identified_by NA
insert_size_range 150bp PE
institution_name Museum and Art Gallery of the Northern Territory
library_comments NA
library_construction_protocol NEXTFLEX_2.0_RapidDNASeq
library_id 102.100.100/455048
library_index_id P7_UDI_0204
library_index_id_dual P5_UDI_0204
library_index_seq GAATTTCTCG
library_index_seq_dual AGTCGCGAGT
library_layout paired end
library_location ANU EBL Freezer
library_ng_ul 25.7
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTTCTCGATCTCGTATGCCGTCTTCTGCTTG
library_oligo_sequence_dual AATGATACGGCGACCACCGAGATCTACACAGTCGCGAGTACACTCTTTCCCTACACGACGCTCTTCCGATC
library_pcr_cycles 12
library_pcr_reps 1
library_prep_date 2023-02-20
library_prepared_by Liz Broady
library_selection Hybrid Selection
library_source GENOMIC
library_strategy Targeted-Capture
library_type Exon Capture
lifestage unknown
location_text unknown
material_conc_ng_ul 184.0
material_extracted_by Janne Torkkola
material_extraction_date 2023-01-19
material_extraction_method NucleoSpin Kit
material_extraction_type DNA
metadata_revision_date 2024-11-15
metadata_revision_filename AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx
method_of_determination NA
n_libraries_pooled 227
order Squamata
phenotypic_sex not determined
phylum Chordata
prior_genetics NA
project_aim Phylogenomics
sample_custodian Paul M Oliver
sample_id 102.100.100/412284
sample_quality unknown
scientific_name Glaphyromorphus darwiniensis
sequencing_facility BRF
sequencing_kit_chemistry_version 300 cycles
sequencing_model NovaSeq 6000
sequencing_platform Illumina
source_population NA
species darwiniensis
specimen_id MAGNT_R21755
specimen_id_description Museum and Art Gallery of the Northern Territory
state_or_region unknown
subspecies NA
taxon_id 221264
taxonomic_group Squamata
ticket BPAOPS-1540
tissue_collection Museum and Art Gallery of the Northern Territory
tissue_number ABTC29653
tissue_preservation frozen
tissue_type liver
type_status NA
voucher_or_tissue_number MAGNT_R21755
wild_captive wild
work_order 13075