South-Eastern Kimberley Sand Slider, Phylogenomics, Illumina-shortread, unknown
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members |
| Access Control Date | 2023-12-30 |
| Access Control Mode | date |
| Sequence Data Type | Illumina-shortread |
| access_rights | No restrictions |
| ala_specimen_url | NA |
| analysis_software | Bcl2Fastq |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/illumina-fastq/BPAOPS-1540/20231219_AusARG_BRF_351863_HWLHCDRX3/ |
| bioplatforms_dataset_id | 102.100.100/351863 |
| bioplatforms_library_id | 102.100.100/454944 |
| bioplatforms_sample_id | 102.100.100/412181 |
| certainty | NA |
| class | Reptilia |
| collection_method | NA |
| collector | NA |
| collector_sample_id | NA |
| common_name | South-Eastern Kimberley Sand Slider |
| country | Australia |
| data_context | Phylogenomics |
| data_custodian | Janne Torkkola |
| data_type | Illumina-shortread |
| dataset_id | 102.100.100/351863 |
| date_of_transfer | 2023-12-20 |
| date_of_transfer_to_archive | 2023-12-20 |
| decimal_latitude_public | -17.2666 |
| decimal_longitude_public | 128.4833 |
| description | Short reads |
| dna_treatment | 2 Biorupter cycles |
| experimental_design | Capture probes |
| facility | BRF |
| family | Scincidae |
| file_type | FASTQ |
| flowcell_id | HWLHCDRX3 |
| flowcell_type | Novaseq SP |
| folder_name | 20231219_AusARG_BRF_351863_HWLHCDRX3 |
| genotypic_sex | not determined |
| genus | Lerista |
| habitat | NA |
| identified_by | NA |
| insert_size_range | 150bp PE |
| institution_name | Western Australian Museum |
| latitude | -17.2666 |
| library_comments | NA |
| library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
| library_id | 102.100.100/454944 |
| library_index_id | P7_UDI_0291 |
| library_index_id_dual | P5_UDI_0291 |
| library_index_seq | GAATTAGGAT |
| library_index_seq_dual | GAGCGTTTAG |
| library_layout | paired end |
| library_location | ANU EBL Freezer |
| library_ng_ul | 0.0 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTAGGATATCTCGTATGCCGTCTTCTGCTTG |
| library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACGAGCGTTTAGACACTCTTTCCCTACACGACGCTCTTCCGATC |
| library_pcr_cycles | 12 |
| library_pcr_reps | 1 |
| library_prep_date | 2023-02-20 |
| library_prepared_by | Janne Torkkola |
| library_selection | Hybrid Selection |
| library_source | GENOMIC |
| library_strategy | Targeted-Capture |
| library_type | Exon Capture |
| lifestage | unknown |
| location_text | FOWLHOUSE JUNCTION, OSMOND RANGE |
| longitude | 128.4833 |
| material_conc_ng_ul | 4.75 |
| material_extracted_by | Janne Torkkola |
| material_extraction_date | 2022-12-14 |
| material_extraction_method | NucleoSpin Kit |
| material_extraction_type | DNA |
| metadata_revision_date | 2024-11-15 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx |
| method_of_determination | NA |
| n_libraries_pooled | 227 |
| order | Squamata |
| phenotypic_sex | not determined |
| phylum | Chordata |
| prior_genetics | NA |
| project_aim | Phylogenomics |
| sample_custodian | Paul M Oliver |
| sample_id | 102.100.100/412181 |
| sample_quality | unknown |
| scientific_name | Lerista greeri |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | 300 cycles |
| sequencing_model | NovaSeq 6000 |
| sequencing_platform | Illumina |
| source_population | NA |
| species | greeri |
| specimen_id | WAM_R137387 |
| specimen_id_description | Western Australian Museum Herpetology Collection |
| state_or_region | Western Australia |
| subspecies | NA |
| taxon_id | 470350 |
| taxonomic_group | Squamata |
| ticket | BPAOPS-1540 |
| tissue_collection | Western Australian Museum Herpetology Collection |
| tissue_number | WAM_R137387 |
| tissue_preservation | unknown |
| tissue_type | unknown |
| type_status | NA |
| voucher_or_tissue_number | WAM_R137387 |
| wild_captive | wild |
| work_order | 13075 |