Juno’s snake-eyed skink, Conservation genomics, Illumina-shortread, tail tip
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members |
| Access Control Date | 2022-11-25 |
| Access Control Mode | date |
| Sequence Data Type | Illumina-shortread |
| access_rights | no restrictions |
| ala_specimen_url | NA |
| analysis_software | NovaSeq Control Software (NCS) v1.7.5 and Real Time Analysis (RTA) v3.4.4, DRAGEN BCL Convert 07.021.609.3.9.3 |
| analysis_software_version | NovaSeq Control Software (NCS) v1.7.5 and Real Time Analysis (RTA) v3.4.4, DRAGEN BCL Convert 07.021.609.3.9.3 |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/illumina-fastq/BPAOPS-1338/20221115_AusARG_AGRF_HGCMNDSX5/ |
| bioplatforms_dataset_id | 102.100.100/351839 |
| bioplatforms_library_id | 102.100.100/412583 |
| bioplatforms_sample_id | 102.100.100/410974 |
| certainty | NA |
| class | Reptilia |
| collection_date | 2013-05-17 |
| collection_method | hand caught |
| collector | Craig Moritz |
| common_name | Juno’s snake-eyed skink |
| country | Australia |
| data_context | Conservation genomics |
| data_custodian | Sofia Hayden |
| data_type | Illumina-shortread |
| dataset_id | 102.100.100/351839 |
| date_of_transfer | 2022-11-15 |
| date_of_transfer_to_archive | 2022-11-16 |
| decimal_latitude_public | -15.87476 |
| decimal_longitude_public | 129.05128 |
| description | Short reads |
| dna_treatment | 4 Biorupter cycles |
| facility | AGRF |
| facility_project_code | CAGRF220911985 |
| family | Scincidae |
| file_type | .fastq.gz |
| flowcell_id | HGCMNDSX5 |
| flowcell_type | S4 |
| folder_name | 20221115_AusARG_AGRF_HGCMNDSX5 |
| genotypic_sex | not determined |
| genus | Cryptoblepharus |
| habitat | unknown |
| i5_index_reverse_complement | CGGCGATACA |
| identified_by | Craig Moritz |
| insert_size_range | 150bp PE |
| institution_name | Moritz Lab ANU |
| latitude | -15.87476 |
| library_comments | PCR were split across 2 reactions and combined before cleaning |
| library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
| library_id | 102.100.100/412583 |
| library_index_id | P7_UDI_0784 |
| library_index_id_dual | P5_UDI_0784 |
| library_index_seq | TTTACAAGAT |
| library_index_seq_dual | TGTATCGCCG |
| library_layout | Paired end |
| library_location | EBL Freezer |
| library_ng_ul | 26.6300304051 |
| library_oligo_sequence | AATGATACGGCGACCACCGAGATCTACACTTTACAAGATACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| library_oligo_sequence_dual | GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGTATCGCCGATCTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 12 |
| library_pcr_reps | 2 |
| library_prep_date | 2022-08-31 |
| library_prepared_by | Sofia Hayden |
| library_selection | size fractionation |
| library_source | GENOMIC |
| library_strategy | WGS |
| library_type | WGS |
| lifestage | subadult |
| location_text | Keep River Gurrandalng Campground |
| longitude | 129.05128 |
| material_conc_ng_ul | 4.44 |
| material_extracted_by | Mozes Blom |
| material_extraction_method | salt precipitation method |
| material_extraction_type | DNA |
| metadata_revision_date | 2024-11-15 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx |
| method_of_determination | visual determination |
| n_libraries_pooled | 80 |
| order | Squamata |
| phenotypic_sex | female |
| phylum | Chordata |
| prior_genetics | NA |
| project_aim | Conservation Genomics |
| sample_custodian | Craig Moritz |
| sample_id | 102.100.100/410974 |
| sample_quality | unknown |
| scientific_name | Cryptoblepharus juno |
| sequencing_facility | AGRF |
| sequencing_kit_chemistry_version | NovaSeq v1.5 |
| sequencing_model | NovaSeq 6000 SP, 300 cycle |
| sequencing_platform | ILLUMINA |
| source_population | Australia, Northern Territory |
| species | juno |
| specimen_id | no voucher |
| specimen_id_description | Moritz Lab ANU |
| state_or_region | Northern Territory |
| subspecies | NA |
| taxon_id | 2509231 |
| taxonomic_group | reptile |
| ticket | BPAOPS-1338 |
| tissue_collection | Craig Moritz's tissue collection |
| tissue_number | CCM0678 |
| tissue_preservation | RNAlater |
| tissue_type | tail tip |
| type_status | unknown |
| voucher_or_tissue_number | CCM0678 |
| wild_captive | wild |
| work_order | 13050 |