Dappled Snake-Eyed Skink, Conservation genomics, Illumina-shortread, tail tip

Scincidae, Cryptoblepharus daedalos, no voucher, reptile, Project Lead: Sofia Hayden

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members
Access Control Date 2022-11-25
Access Control Mode date
Sequence Data Type Illumina-shortread
access_rights no restrictions
ala_specimen_url NA
analysis_software NovaSeq Control Software (NCS) v1.7.5 and Real Time Analysis (RTA) v3.4.4, DRAGEN BCL Convert 07.021.609.3.9.3
analysis_software_version NovaSeq Control Software (NCS) v1.7.5 and Real Time Analysis (RTA) v3.4.4, DRAGEN BCL Convert 07.021.609.3.9.3
ancillary_notes NA
associated_media NA
barcode_id NA
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/illumina-fastq/BPAOPS-1338/20221115_AusARG_AGRF_HGCMNDSX5/
bioplatforms_dataset_id 102.100.100/351839
bioplatforms_library_id 102.100.100/412570
bioplatforms_sample_id 102.100.100/410961
certainty NA
class Reptilia
collection_date 2013-05-11
collection_method hand caught
collector Craig Moritz
common_name Dappled Snake-Eyed Skink
country Australia
data_context Conservation genomics
data_custodian Sofia Hayden
data_type Illumina-shortread
dataset_id 102.100.100/351839
date_of_transfer 2022-11-15
date_of_transfer_to_archive 2022-11-16
decimal_latitude_public -15.61091
decimal_longitude_public 131.11597
description Short reads
dna_treatment 4 Biorupter cycles
facility AGRF
facility_project_code CAGRF220911985
family Scincidae
file_type .fastq.gz
flowcell_id HGCMNDSX5
flowcell_type S4
folder_name 20221115_AusARG_AGRF_HGCMNDSX5
genotypic_sex not determined
genus Cryptoblepharus
habitat unknown
i5_index_reverse_complement TACTCCTATA
identified_by Craig Moritz
insert_size_range 150bp PE
institution_name Australian National University
latitude -15.61091
library_comments PCR were split across 2 reactions and combined before cleaning
library_construction_protocol NEXTFLEX_2.0_RapidDNASeq
library_id 102.100.100/412570
library_index_id P7_UDI_0771
library_index_id_dual P5_UDI_0771
library_index_seq TTGGCTAGGT
library_index_seq_dual TATAGGAGTA
library_layout Paired end
library_location EBL Freezer
library_ng_ul 8.6236207737
library_oligo_sequence AATGATACGGCGACCACCGAGATCTACACTTGGCTAGGTACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_oligo_sequence_dual GATCGGAAGAGCACACGTCTGAACTCCAGTCACTATAGGAGTAATCTCGTATGCCGTCTTCTGCTTG
library_pcr_cycles 12
library_pcr_reps 2
library_prep_date 2022-08-31
library_prepared_by Sofia Hayden
library_selection size fractionation
library_source GENOMIC
library_strategy WGS
library_type WGS
lifestage unknown
location_text Vic River Region Escarpment Walk
longitude 131.11597
material_conc_ng_ul 38.6
material_extracted_by Leonardo Tedeschi
material_extraction_date 2022-08-22
material_extraction_method salt precipitation method
material_extraction_type DNA
metadata_revision_date 2024-11-15
metadata_revision_filename AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx
method_of_determination visual determination
n_libraries_pooled 80
order Squamata
phenotypic_sex female
phylum Chordata
prior_genetics NA
project_aim Conservation Genomics
sample_custodian Craig Moritz
sample_id 102.100.100/410961
sample_quality unknown
scientific_name Cryptoblepharus daedalos
sequencing_facility AGRF
sequencing_kit_chemistry_version NovaSeq v1.5
sequencing_model NovaSeq 6000 SP, 300 cycle
sequencing_platform ILLUMINA
source_population Australia, Northern Territory
species daedalos
specimen_id no voucher
specimen_id_description Moritz Lab ANU
state_or_region Northern Territory
subspecies NA
taxon_id 2509229
taxonomic_group reptile
ticket BPAOPS-1338
tissue_collection Craig Moritz's tissue collection
tissue_number CCM0526
tissue_preservation RNAlater
tissue_type tail tip
type_status unknown
voucher_or_tissue_number CCM0526
wild_captive wild
work_order 13050