Black Mountain Rainbow Skink, Phylogenomics, Illumina Capture, unknown
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members |
| Access Control Date | 2024-02-03 |
| Access Control Mode | date |
| Sequence Data Type | Illumina Capture |
| access_rights | No restrictions |
| ala_specimen_url | 98302ebe-0a8b-4cec-a855-6fe36028d785 |
| analysis_software | Bcl2Fastq |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/illumina-fastq/BPAOPS-1556/20240124_AusARG_BRF_351835_HWWNTDRX3/ |
| bioplatforms_dataset_id | 102.100.100/351835 |
| bioplatforms_library_id | 102.100.100/354537 |
| bioplatforms_sample_id | 102.100.100/410689 |
| certainty | NA |
| class | Reptilia |
| collection_date | 2002-10-14 |
| collection_method | unknown |
| collector | unknown |
| collector_sample_id | NA |
| common_name | Black Mountain Rainbow Skink |
| country | Australia |
| data_context | Phylogenomics |
| data_custodian | Craig Moritz |
| data_type | Illumina Capture |
| dataset_id | 102.100.100/351835 |
| date_of_transfer | 2024-01-24 |
| date_of_transfer_to_archive | 2024-02-08 |
| decimal_latitude_public | -15.646944 |
| decimal_longitude_public | 145.22 |
| description | Short reads |
| dna_treatment | 50 Bioruptor cycles |
| experimental_design | Capture probes |
| facility | BRF |
| facility_project_code | BRF |
| facility_sample_id | 354537_AusARG_BRF_HWWNTDRX3_CTAGACATTA |
| family | Scincidae |
| file_type | FASTQ |
| flowcell_id | HWWNTDRX3 |
| flowcell_type | Novaseq S1 |
| folder_name | 20240124_AusARG_BRF_351835_HWWNTDRX3 |
| genotypic_sex | not determined |
| genus | Liburnascincus |
| habitat | unknown |
| identified_by | unknown |
| insert_size_range | 150bp PE |
| institution_name | Queensland Museum |
| latitude | -15.646944 |
| library_comments | NA |
| library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
| library_id | 102.100.100/354537 |
| library_index_id | p7_UDI_0403 |
| library_index_id_dual | p5_UDI_0403 |
| library_index_seq | CTAGACATTA |
| library_index_seq_dual | ATATTTGGCA |
| library_layout | paired end |
| library_location | EBL Freezers |
| library_ng_ul | 1.8 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTAGACATTAATCTCGTATGCCGTCTTCTGCTTG |
| library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACATATTTGGCAACACTCTTTCCCTACACGACGCTCTTCCGATC |
| library_pcr_cycles | 12 |
| library_pcr_reps | 2 |
| library_prep_date | 2022-05-06 |
| library_prepared_by | Liz Broady |
| library_selection | Hybrid Selection |
| library_source | GENOMIC |
| library_strategy | Targeted-Capture |
| library_type | SqCL2/Exon Capture |
| lifestage | unknown |
| location_text | Black Mt, via Cooktown |
| longitude | 145.22 |
| material_conc_ng_ul | 18.9 |
| material_extracted_by | Sally Potter |
| material_extraction_date | 2016-01-01 |
| material_extraction_method | Salt extraction |
| material_extraction_type | DNA |
| metadata_revision_date | 2024-11-15 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx |
| method_of_determination | NA |
| n_libraries_pooled | 305 |
| order | Squamata |
| phenotypic_sex | not determined |
| phylum | Chordata |
| prior_genetics | NA |
| project_aim | Phylogenomics |
| sample_custodian | Patrick Couper |
| sample_id | 102.100.100/410689 |
| sample_quality | unknown |
| scientific_name | Liburnascincus scirtetis |
| sequencing_facility | Biomolecular Research Facility - ANU |
| sequencing_kit_chemistry_version | 300 cycles |
| sequencing_model | NovaSeq 6000 |
| sequencing_platform | Illumina |
| source_population | NA |
| species | scirtetis |
| specimen_id | QM J78401 |
| specimen_id_description | Queensland Museum Amphibians and Reptiles |
| state_or_region | Queensland |
| subspecies | NA |
| taxon_id | 583261 |
| taxonomic_group | Squamata |
| ticket | BPAOPS-1556 |
| tissue_collection | Queensland Museum Amphibians and Reptiles |
| tissue_number | J78401 |
| tissue_preservation | ethanol |
| tissue_type | unknown |
| type_status | NA |
| voucher_or_tissue_number | QM J78401 |
| wild_captive | wild |
| work_order | 13077 |