southern gastric-brooding frog, Reference genome, Illumina-shortread, Tadpole
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members |
| Access Control Date | 2022-04-14 |
| Access Control Mode | date |
| Sequence Data Type | Illumina-shortread |
| access_rights | No restrictions |
| ala_specimen_url | NA |
| analysis_software | Real Time Analysis (RTA |
| analysis_software_version | v3.4.4 |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/illumina-fastq/BPAOPS-1215/20220404_AusARG_AGRF_HJLC5DSX3/ |
| bioplatforms_dataset_id | 102.100.100/351821 |
| bioplatforms_library_id | 102.100.100/354323 |
| bioplatforms_sample_id | 102.100.100/353085 |
| certainty | NA |
| class | Amphibia |
| collection_date | 1978-12-22 |
| collection_method | hand capture |
| collector | Michael Tyler |
| collector_sample_id | NA |
| common_name | southern gastric-brooding frog |
| country | Australia |
| data_context | Reference genome |
| data_custodian | Steve Donnellan |
| data_type | Illumina-shortread |
| dataset_id | 102.100.100/351821 |
| date_of_transfer | 2022-04-04 |
| date_of_transfer_to_archive | 2022-04-04 |
| death_date | 1978-12-22 |
| description | Short reads |
| dna_treatment | not fragmented |
| experimental_design | shotgun seq dual index |
| facility | AGRF |
| facility_project_code | CAGRF22039832 |
| facility_sample_id | 354323.0 |
| family | Myobatrachidae |
| file_type | fastq |
| flowcell_id | HJLC5DSX3 |
| flowcell_type | S4-300 |
| folder_name | 20220404_AusARG_AGRF_HJLC5DSX3 |
| genotypic_sex | not determined |
| genus | Rheobatrachus |
| habitat | unknown |
| insert_size_range | 178-610 |
| institution_name | South Australian Museum |
| library_comments | shotgun seq |
| library_construction_protocol | Myer_Kircher 2010 |
| library_id | 102.100.100/354323 |
| library_index_id | iP7-146-GTCTATGA |
| library_index_id_dual | iP5-11-AACAACCG |
| library_index_seq | GTCTATGA |
| library_index_seq_dual | CGGTTGTT |
| library_layout | paired end |
| library_location | Adelaide Uni |
| library_ng_ul | 1.4 |
| library_oligo_sequence | CAAGCAGAAGACGGCATACGAGATTCATAGACGTGACTGGAGTTCAGACGTGT |
| library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACAACAACCGACACTCTTTCCCTACACGACGCTCTT |
| library_pcr_cycles | 14 |
| library_pcr_reps | 0 |
| library_prep_date | 2022-10-28 |
| library_prepared_by | Tessa Bradford |
| library_selection | RANDOM |
| library_source | GENOMIC |
| library_strategy | OTHER |
| library_type | Illumina-shortread |
| lifestage | Tadpole |
| location_text | No locality data |
| material_conc_ng_ul | 28.0 |
| material_extracted_by | Tessa Bradford |
| material_extraction_date | 2021-09-14 |
| material_extraction_method | Gentra PureGene |
| material_extraction_type | DNA |
| metadata_revision_date | 2024-11-15 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx |
| method_of_determination | NA |
| n_libraries_pooled | 5 |
| order | Anura |
| phenotypic_sex | not determined |
| phylum | Chordata |
| prior_genetics | NA |
| project_aim | Reference genome |
| sample_custodian | Steve Donnellan |
| sample_id | 102.100.100/353085 |
| sample_quality | degraded |
| scientific_name | Rheobatrachus silus |
| sequencing_facility | AGRF |
| sequencing_kit_chemistry_version | NovaSeq Control Software (NCS) v1.7.5 |
| sequencing_model | Illumina NovaSeq 6000 |
| sequencing_platform | ILLUMINA |
| source_population | NA |
| species | silus |
| specimen_id | ABTC80608 |
| specimen_id_description | South Australian Museum |
| state_or_region | Queensland |
| subspecies | NA |
| taxon_id | 353085 |
| taxonomic_group | frog |
| ticket | BPAOPS-1215 |
| tissue_collection | Australian Biological Tissue Collection |
| tissue_number | ABTC80608 |
| tissue_preservation | ethanol |
| tissue_type | Tadpole |
| type_status | no |
| voucher_or_tissue_number | ABTC80608 |
| wild_captive | wild |
| work_order | 13043 |